ID: 1052703803

View in Genome Browser
Species Human (GRCh38)
Location 9:31969966-31969988
Sequence ATGTTGTAGCTAAATAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052703801_1052703803 8 Left 1052703801 9:31969935-31969957 CCTGACTCTGCTCTTCAGGTCTC No data
Right 1052703803 9:31969966-31969988 ATGTTGTAGCTAAATAAAAAAGG No data
1052703797_1052703803 19 Left 1052703797 9:31969924-31969946 CCACACCCTGTCCTGACTCTGCT No data
Right 1052703803 9:31969966-31969988 ATGTTGTAGCTAAATAAAAAAGG No data
1052703799_1052703803 13 Left 1052703799 9:31969930-31969952 CCTGTCCTGACTCTGCTCTTCAG No data
Right 1052703803 9:31969966-31969988 ATGTTGTAGCTAAATAAAAAAGG No data
1052703798_1052703803 14 Left 1052703798 9:31969929-31969951 CCCTGTCCTGACTCTGCTCTTCA No data
Right 1052703803 9:31969966-31969988 ATGTTGTAGCTAAATAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052703803 Original CRISPR ATGTTGTAGCTAAATAAAAA AGG Intergenic
No off target data available for this crispr