ID: 1052707173

View in Genome Browser
Species Human (GRCh38)
Location 9:32008145-32008167
Sequence CTGTGAATCCATATGAACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052707168_1052707173 10 Left 1052707168 9:32008112-32008134 CCAGCTACTCTTTGCACCTCTGG No data
Right 1052707173 9:32008145-32008167 CTGTGAATCCATATGAACCTGGG No data
1052707171_1052707173 -6 Left 1052707171 9:32008128-32008150 CCTCTGGTAGAATTCGGCTGTGA 0: 5309
1: 5374
2: 2476
3: 988
4: 423
Right 1052707173 9:32008145-32008167 CTGTGAATCCATATGAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052707173 Original CRISPR CTGTGAATCCATATGAACCT GGG Intergenic
No off target data available for this crispr