ID: 1052707173 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:32008145-32008167 |
Sequence | CTGTGAATCCATATGAACCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1052707168_1052707173 | 10 | Left | 1052707168 | 9:32008112-32008134 | CCAGCTACTCTTTGCACCTCTGG | No data | ||
Right | 1052707173 | 9:32008145-32008167 | CTGTGAATCCATATGAACCTGGG | No data | ||||
1052707171_1052707173 | -6 | Left | 1052707171 | 9:32008128-32008150 | CCTCTGGTAGAATTCGGCTGTGA | 0: 5309 1: 5374 2: 2476 3: 988 4: 423 |
||
Right | 1052707173 | 9:32008145-32008167 | CTGTGAATCCATATGAACCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1052707173 | Original CRISPR | CTGTGAATCCATATGAACCT GGG | Intergenic | ||
No off target data available for this crispr |