ID: 1052707556

View in Genome Browser
Species Human (GRCh38)
Location 9:32011120-32011142
Sequence CTGTGGGACTGGCAGCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052707556_1052707566 10 Left 1052707556 9:32011120-32011142 CCAGCTGGCTGCCAGTCCCACAG No data
Right 1052707566 9:32011153-32011175 GAATTTGTTGTGCCTTTTCTGGG No data
1052707556_1052707567 21 Left 1052707556 9:32011120-32011142 CCAGCTGGCTGCCAGTCCCACAG No data
Right 1052707567 9:32011164-32011186 GCCTTTTCTGGGCCTGCCCATGG No data
1052707556_1052707565 9 Left 1052707556 9:32011120-32011142 CCAGCTGGCTGCCAGTCCCACAG No data
Right 1052707565 9:32011152-32011174 GGAATTTGTTGTGCCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052707556 Original CRISPR CTGTGGGACTGGCAGCCAGC TGG (reversed) Intergenic
No off target data available for this crispr