ID: 1052710989

View in Genome Browser
Species Human (GRCh38)
Location 9:32055225-32055247
Sequence ATTGTAAAAAGCAGAATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052710989_1052710991 5 Left 1052710989 9:32055225-32055247 CCTAAAATTCTGCTTTTTACAAT No data
Right 1052710991 9:32055253-32055275 CTCTCAAAACGTATTTTCTATGG No data
1052710989_1052710992 16 Left 1052710989 9:32055225-32055247 CCTAAAATTCTGCTTTTTACAAT No data
Right 1052710992 9:32055264-32055286 TATTTTCTATGGCTCATGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052710989 Original CRISPR ATTGTAAAAAGCAGAATTTT AGG (reversed) Intergenic
No off target data available for this crispr