ID: 1052712052

View in Genome Browser
Species Human (GRCh38)
Location 9:32068984-32069006
Sequence ATTAGTGAAGTGTCTTCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052712052_1052712053 -7 Left 1052712052 9:32068984-32069006 CCATAGGAAGACACTTCACTAAT No data
Right 1052712053 9:32069000-32069022 CACTAATGTAACACTGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052712052 Original CRISPR ATTAGTGAAGTGTCTTCCTA TGG (reversed) Intergenic
No off target data available for this crispr