ID: 1052714049

View in Genome Browser
Species Human (GRCh38)
Location 9:32093355-32093377
Sequence CTGCTCCCGTTACCTAGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052714049_1052714050 -3 Left 1052714049 9:32093355-32093377 CCAATTCTAGGTAACGGGAGCAG No data
Right 1052714050 9:32093375-32093397 CAGTGTATCTTCAGTCATTCAGG No data
1052714049_1052714051 4 Left 1052714049 9:32093355-32093377 CCAATTCTAGGTAACGGGAGCAG No data
Right 1052714051 9:32093382-32093404 TCTTCAGTCATTCAGGCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052714049 Original CRISPR CTGCTCCCGTTACCTAGAAT TGG (reversed) Intergenic
No off target data available for this crispr