ID: 1052723404

View in Genome Browser
Species Human (GRCh38)
Location 9:32200364-32200386
Sequence CCTACCATGTGGAAGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052723398_1052723404 -7 Left 1052723398 9:32200348-32200370 CCTTAGGCCATTACCACCTACCA No data
Right 1052723404 9:32200364-32200386 CCTACCATGTGGAAGGAAGCTGG No data
1052723395_1052723404 27 Left 1052723395 9:32200314-32200336 CCTGCTCAAAGAAAGTATCTTTT No data
Right 1052723404 9:32200364-32200386 CCTACCATGTGGAAGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052723404 Original CRISPR CCTACCATGTGGAAGGAAGC TGG Intergenic
No off target data available for this crispr