ID: 1052725048

View in Genome Browser
Species Human (GRCh38)
Location 9:32219278-32219300
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052725046_1052725048 12 Left 1052725046 9:32219243-32219265 CCAGGAAGAAATCTTTATAAAAC No data
Right 1052725048 9:32219278-32219300 AGTATTAAAGTGTTTCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052725048 Original CRISPR AGTATTAAAGTGTTTCTAGA AGG Intergenic
No off target data available for this crispr