ID: 1052726863

View in Genome Browser
Species Human (GRCh38)
Location 9:32239066-32239088
Sequence GTCAGACAGCTGGCCAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052726863_1052726865 15 Left 1052726863 9:32239066-32239088 CCAAATTTGGCCAGCTGTCTGAC No data
Right 1052726865 9:32239104-32239126 TGACTTTGAACTAACGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052726863 Original CRISPR GTCAGACAGCTGGCCAAATT TGG (reversed) Intergenic
No off target data available for this crispr