ID: 1052729027

View in Genome Browser
Species Human (GRCh38)
Location 9:32263861-32263883
Sequence TTCCCTTCACTTATGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052729027_1052729030 17 Left 1052729027 9:32263861-32263883 CCCTTTTTCATAAGTGAAGGGAA No data
Right 1052729030 9:32263901-32263923 AAGGCTTATGATCATCATACTGG No data
1052729027_1052729029 -2 Left 1052729027 9:32263861-32263883 CCCTTTTTCATAAGTGAAGGGAA No data
Right 1052729029 9:32263882-32263904 AAATGTCTTAAAATTAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052729027 Original CRISPR TTCCCTTCACTTATGAAAAA GGG (reversed) Intergenic
No off target data available for this crispr