ID: 1052730313

View in Genome Browser
Species Human (GRCh38)
Location 9:32277654-32277676
Sequence ACTGGGACATTGGTCTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052730313_1052730315 -9 Left 1052730313 9:32277654-32277676 CCAGAAAAGACCAATGTCCCAGT No data
Right 1052730315 9:32277668-32277690 TGTCCCAGTTCAAAACACTCAGG No data
1052730313_1052730318 -5 Left 1052730313 9:32277654-32277676 CCAGAAAAGACCAATGTCCCAGT No data
Right 1052730318 9:32277672-32277694 CCAGTTCAAAACACTCAGGCAGG No data
1052730313_1052730319 -2 Left 1052730313 9:32277654-32277676 CCAGAAAAGACCAATGTCCCAGT No data
Right 1052730319 9:32277675-32277697 GTTCAAAACACTCAGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052730313 Original CRISPR ACTGGGACATTGGTCTTTTC TGG (reversed) Intergenic
No off target data available for this crispr