ID: 1052730863

View in Genome Browser
Species Human (GRCh38)
Location 9:32283630-32283652
Sequence ATGTTCATCTGCAAGTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052730863_1052730864 -2 Left 1052730863 9:32283630-32283652 CCATCACACTTGCAGATGAACAT No data
Right 1052730864 9:32283651-32283673 ATGAGAACAGAGAAGTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052730863 Original CRISPR ATGTTCATCTGCAAGTGTGA TGG (reversed) Intergenic
No off target data available for this crispr