ID: 1052732625

View in Genome Browser
Species Human (GRCh38)
Location 9:32307470-32307492
Sequence ATTTTTAAGGGGATTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052732625_1052732637 14 Left 1052732625 9:32307470-32307492 CCCTCCACAATCCCCTTAAAAAT No data
Right 1052732637 9:32307507-32307529 CTCTGGGAAGATGGATTTGAGGG No data
1052732625_1052732636 13 Left 1052732625 9:32307470-32307492 CCCTCCACAATCCCCTTAAAAAT No data
Right 1052732636 9:32307506-32307528 TCTCTGGGAAGATGGATTTGAGG No data
1052732625_1052732633 -2 Left 1052732625 9:32307470-32307492 CCCTCCACAATCCCCTTAAAAAT No data
Right 1052732633 9:32307491-32307513 ATCTCAGGCCAAGACTCTCTGGG No data
1052732625_1052732634 5 Left 1052732625 9:32307470-32307492 CCCTCCACAATCCCCTTAAAAAT No data
Right 1052732634 9:32307498-32307520 GCCAAGACTCTCTGGGAAGATGG No data
1052732625_1052732632 -3 Left 1052732625 9:32307470-32307492 CCCTCCACAATCCCCTTAAAAAT No data
Right 1052732632 9:32307490-32307512 AATCTCAGGCCAAGACTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052732625 Original CRISPR ATTTTTAAGGGGATTGTGGA GGG (reversed) Intergenic
No off target data available for this crispr