ID: 1052734671

View in Genome Browser
Species Human (GRCh38)
Location 9:32328812-32328834
Sequence GTTCAGCAGCACCGTGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052734670_1052734671 -7 Left 1052734670 9:32328796-32328818 CCAAATCAGACTGGCTGTTCAGC No data
Right 1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG No data
1052734668_1052734671 5 Left 1052734668 9:32328784-32328806 CCAAAGAAGATGCCAAATCAGAC No data
Right 1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG No data
1052734667_1052734671 19 Left 1052734667 9:32328770-32328792 CCTCTGTAACTCTTCCAAAGAAG No data
Right 1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052734671 Original CRISPR GTTCAGCAGCACCGTGCTGT AGG Intergenic
No off target data available for this crispr