ID: 1052736944

View in Genome Browser
Species Human (GRCh38)
Location 9:32352385-32352407
Sequence CTCCATGGGAAGCAGTGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052736938_1052736944 -8 Left 1052736938 9:32352370-32352392 CCTGCCAGCTGCAGCCTCCATGG No data
Right 1052736944 9:32352385-32352407 CTCCATGGGAAGCAGTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052736944 Original CRISPR CTCCATGGGAAGCAGTGACA GGG Intergenic
No off target data available for this crispr