ID: 1052742620

View in Genome Browser
Species Human (GRCh38)
Location 9:32408108-32408130
Sequence TTTGACCAGATTTCAAGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 255}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052742620_1052742623 11 Left 1052742620 9:32408108-32408130 CCATTCCTTGAAATCTGGTCAAA 0: 1
1: 0
2: 3
3: 19
4: 255
Right 1052742623 9:32408142-32408164 GTGATCTGAAAGTCTTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052742620 Original CRISPR TTTGACCAGATTTCAAGGAA TGG (reversed) Intronic
900995761 1:6122623-6122645 TTTGGGCAGATATCTAGGAATGG - Intronic
902521870 1:17022867-17022889 CTTGTCCATCTTTCAAGGAAAGG + Intronic
903637319 1:24831559-24831581 TTTGATCAGATTACAATGAATGG - Intronic
903801424 1:25971341-25971363 TTTGAACAGATTTCCAAGAGAGG - Intronic
904879719 1:33686475-33686497 TATTACCAGGGTTCAAGGAAAGG + Intronic
904929449 1:34074805-34074827 TTTGACCAGGTTGTGAGGAAAGG + Intronic
907640642 1:56186062-56186084 TTTTACCAGCTTTCCAGAAAAGG - Intergenic
907864614 1:58387678-58387700 TTTGACGAGATTTCTAGGGAGGG + Intronic
910220888 1:84888772-84888794 ATTGACCAGTTATCAAGGGATGG - Intronic
917835153 1:178935878-178935900 GTTGACCAGGCCTCAAGGAATGG + Intergenic
918531801 1:185531119-185531141 TTAGACCAGATCTCATGGAGTGG - Intergenic
920802089 1:209198984-209199006 TTTGATGAGATTCCTAGGAAGGG - Intergenic
924758334 1:246962334-246962356 TTACACCAGAGTTCAGGGAAAGG + Intronic
1063277290 10:4583978-4584000 TTTGAACACATGTGAAGGAAAGG - Intergenic
1063966100 10:11347110-11347132 CTTGCCCAGATTTCAAGGGGAGG + Intergenic
1064995177 10:21290506-21290528 TTTGATAAGATTCCTAGGAAGGG - Intergenic
1066048543 10:31615445-31615467 TTTGATAAGATTTCTAGGGAGGG + Intergenic
1066416351 10:35224774-35224796 TGTTATCAGATTTCAAGGTATGG + Intergenic
1066547159 10:36512032-36512054 TTTGAACAGTCTTCAATGAATGG - Intergenic
1066615499 10:37289347-37289369 TGCGACCTGATTTCAATGAAAGG + Intronic
1066644181 10:37588557-37588579 TCAGAGCAGATTTCAGGGAAAGG + Intergenic
1067545447 10:47189475-47189497 TTTGATCAGCTATCAAGGATAGG + Intergenic
1067549948 10:47227180-47227202 TTTGATCAGAGTTCAATGAGGGG - Intergenic
1068647391 10:59482596-59482618 TTTAACCAGATTTCAAAGAATGG - Intergenic
1070088889 10:73264241-73264263 TTTGTCCAGTTTAGAAGGAAAGG - Intronic
1070554328 10:77516279-77516301 TTGGAGCAGATTTCAGGAAAGGG - Intronic
1070641013 10:78169895-78169917 TTTGAGCAGATATCCAGGGAAGG - Intergenic
1071697208 10:87888754-87888776 AATGACCACATTTCAAGGGAGGG + Intronic
1071782020 10:88856530-88856552 ATAGACCAGGTTTCAAGAAAGGG - Intergenic
1072303392 10:94084244-94084266 TTTGACCAAGTTTAAAGAAAAGG + Intronic
1072431384 10:95374573-95374595 ATTGACCAGGTTTTAAGAAAAGG + Intronic
1072501847 10:96025593-96025615 TTTTACCAGATGTCAAGTCACGG - Intronic
1073570874 10:104580154-104580176 ATAAACCTGATTTCAAGGAAAGG - Intergenic
1074111545 10:110426287-110426309 ATTGCCCAGATTTAAAAGAAAGG + Intergenic
1074495563 10:113977442-113977464 ATTGACAAGATTCCAAGGAGTGG - Intergenic
1075269513 10:121036331-121036353 TTTGCCCAGACCTCAAGAAAAGG - Intergenic
1075291465 10:121234901-121234923 TATACCAAGATTTCAAGGAATGG - Intergenic
1077872514 11:6273673-6273695 TTTTATCAGATCTCAAGAAATGG - Intergenic
1079634862 11:22724599-22724621 TTTGTCCAGATATCAAGTAATGG - Intronic
1079817398 11:25078610-25078632 ATTGACCAGCTTTGAAGGGATGG + Exonic
1080051384 11:27862635-27862657 TTTCCTCAGATGTCAAGGAAAGG - Intergenic
1081482836 11:43505290-43505312 TTTAAGCAGATCTGAAGGAAAGG - Intergenic
1085308022 11:75499339-75499361 GATGACCAGATGTCCAGGAAGGG - Intronic
1086895082 11:92302793-92302815 GTTAATAAGATTTCAAGGAAGGG + Intergenic
1087052996 11:93905090-93905112 TTTCACCAGTTTTGAAGGGAGGG + Intergenic
1087335880 11:96843879-96843901 TGGAACCAGATTTAAAGGAAAGG - Intergenic
1088552342 11:111025797-111025819 TTTGATCAGATATCAAGGGTGGG - Intergenic
1088744508 11:112794382-112794404 TATGGCCAGATGTGAAGGAATGG - Intergenic
1089086326 11:115820315-115820337 TTTAATCAGATTCCCAGGAAAGG + Intergenic
1090099424 11:123778519-123778541 TTTCTCCAGTTTTCAAGGTAAGG - Intergenic
1092719112 12:11423318-11423340 TTTGAACAGATTTGAATAAAGGG - Intronic
1093190615 12:16070354-16070376 TTTGACAAGAAATCCAGGAAAGG - Intergenic
1093518863 12:20024255-20024277 TCTCACCAGATCACAAGGAAAGG - Intergenic
1094193639 12:27722760-27722782 TTTAAACAGTGTTCAAGGAATGG + Intronic
1094255243 12:28416639-28416661 TTTGATGAGATATCAAGAAAGGG + Intronic
1097049714 12:56214985-56215007 TTTGACAAGTTTTCCAGGACTGG + Intronic
1097298548 12:57993775-57993797 TCTAACCAGATTTCAACCAATGG - Intergenic
1097482992 12:60154752-60154774 ATTGAGAAGATTTCAATGAATGG + Intergenic
1097718009 12:62987671-62987693 GTTGACCAGAGTTGAAAGAATGG + Intergenic
1099057882 12:77868247-77868269 TTTAACCAAGTTTCATGGAAGGG - Intronic
1099185996 12:79515946-79515968 TTTGCCCAGATTTTTAGGTAAGG + Intergenic
1099482993 12:83191853-83191875 TTAGACCATATTTCAAGAATTGG - Intergenic
1099846971 12:88039586-88039608 TTTAACCAAATTTGAAGCAAAGG - Intronic
1100187779 12:92156349-92156371 TTTGACCAGATTTCTTGGAAGGG - Intergenic
1100720091 12:97348722-97348744 TTTGAACAGATTTGTAAGAAAGG + Intergenic
1101630934 12:106494095-106494117 CTTAATCAGATTTCAAGCAAAGG + Intronic
1102763705 12:115412578-115412600 TCTGACCAGATTTCACGCAGGGG - Intergenic
1105924393 13:24993860-24993882 TTTGTCCTGCTTTCAAGGTATGG - Intergenic
1105979259 13:25501769-25501791 TTTTCCCAGACTTCAGGGAAGGG + Intronic
1106881349 13:34134528-34134550 TTTAACCAGGTGTCAAAGAAAGG + Intergenic
1107224888 13:38036708-38036730 TATGACCAGATTTAAATGATGGG + Intergenic
1109110142 13:58306948-58306970 TTGGAGAATATTTCAAGGAATGG + Intergenic
1109184283 13:59250531-59250553 TGTGACCAGATTTGAGTGAATGG - Intergenic
1110498554 13:76198583-76198605 GTTGACCAGATTATAATGAAGGG + Intergenic
1110758802 13:79207509-79207531 TTTGAGCAGTTATCAAGTAATGG + Intergenic
1110814945 13:79850753-79850775 TTTGACAGAATTTCAAGGAGGGG + Intergenic
1110927679 13:81175879-81175901 ATTGACAAGATTTCAAATAAAGG + Intergenic
1111008510 13:82281555-82281577 TTTGCCTAGATTTCAGAGAACGG - Intergenic
1111189343 13:84788485-84788507 TCTGACCAGAATTCAATGGACGG - Intergenic
1111787862 13:92814184-92814206 TTTGCCCATAATTCAAGGTATGG - Intronic
1112912126 13:104499927-104499949 TTTGTCCAGATTTCACTGCATGG + Intergenic
1114563471 14:23610288-23610310 TTTGCCCAGATTTCAGACAATGG - Intergenic
1115012104 14:28561110-28561132 TTTGACCAGATTTCAGTAAGTGG - Intergenic
1115298176 14:31853925-31853947 TAAGACCAGAATACAAGGAATGG + Intronic
1115756014 14:36526295-36526317 TTTGACCAGAGTCCAAAGAAGGG - Intergenic
1116063279 14:39950918-39950940 TCTAACCAGATTTGAAGGAGAGG + Intergenic
1117789386 14:59323256-59323278 TTTGAGCAGACTTTAAAGAAGGG - Intronic
1119304746 14:73598429-73598451 TTCATCCAGATTTGAAGGAAGGG - Intergenic
1120635877 14:86950366-86950388 TTGGAACAGATTTGAAGAAAGGG + Intergenic
1120722335 14:87902637-87902659 TTTGATCAGGTATCAAGGATGGG - Intronic
1120905960 14:89621536-89621558 TTAGACCAGTTTTCAACAAAGGG - Intergenic
1123019085 14:105389227-105389249 TGTGACCAGACTTCCAGGAGAGG + Intronic
1124935365 15:34165384-34165406 TTTAATCAGGTTTCAAGGAAGGG - Intronic
1127010106 15:54615900-54615922 TTTGAACACATTTCAATAAAGGG - Intronic
1127713449 15:61624324-61624346 TTTGCCCAGATCTTGAGGAATGG - Intergenic
1128669775 15:69566410-69566432 CATGACCAGAATTCAAGGAAGGG + Intergenic
1129874977 15:78968843-78968865 TTTGAGCAGATATCAAGGTGGGG - Intronic
1130686167 15:86039784-86039806 CTTGATCAGATATCAAGGATGGG - Intergenic
1131929242 15:97420340-97420362 TTTGACCACATTCCAAGTCAAGG - Intergenic
1136085079 16:27879021-27879043 TTTGATCAGATATCAAGGCTGGG + Intronic
1136245487 16:28973643-28973665 TTTTACCAGGTTTCAGGGAAAGG - Intergenic
1139056535 16:63192390-63192412 TTTAATTAGCTTTCAAGGAAGGG + Intergenic
1140896601 16:79330440-79330462 TTTGAGCAGAGTTGGAGGAATGG + Intergenic
1141286739 16:82679798-82679820 TTTGAACAGATTTCAAAAATGGG + Intronic
1143880290 17:10024637-10024659 CTTGGCCAGATTGCAAGGACAGG + Intronic
1145004741 17:19331292-19331314 TTAGACCAGATTCCTAGAAATGG + Intronic
1147766352 17:42838996-42839018 CTGGACCAGATTTCTAGGTAGGG + Exonic
1148941760 17:51220323-51220345 TTTGGCCAGACTTCAGGTAACGG - Exonic
1149694619 17:58607200-58607222 TGTTACCAGCTTTCAAAGAAGGG + Intronic
1151028513 17:70707125-70707147 TTTGCCCAAATTTTAAAGAAAGG - Intergenic
1155389786 18:25322675-25322697 TTTGACCAGTTTATAAGTAAAGG - Intronic
1155602206 18:27562523-27562545 TTTAAACAGATATCAAGGATGGG + Intergenic
1158313506 18:56185119-56185141 TTTGACCAGGGTTGAAGCAATGG + Intergenic
1159562071 18:70006719-70006741 TTTGGCCAGAATTCAAGAAAAGG + Intronic
1162202939 19:9034399-9034421 TTTGTCCAGATCTCAAGCTAAGG - Intergenic
1162650980 19:12088898-12088920 TTTGACAAAATTTAAAGGGATGG + Intergenic
1164583754 19:29452229-29452251 TCTGAGTAGATTTCAAGCAAGGG - Intergenic
1167038529 19:47008506-47008528 CTGGACCAGAGTGCAAGGAAAGG - Intergenic
1167268496 19:48494916-48494938 TTTGAGCAGATGTGAAGGAAAGG - Intronic
1167753490 19:51395041-51395063 TCTGGGGAGATTTCAAGGAAGGG - Intergenic
925616498 2:5748826-5748848 TTTCACCAGACTTGAAGGAAAGG - Intergenic
926956996 2:18312500-18312522 TAGGACCAGGTTGCAAGGAATGG - Intronic
927026395 2:19073142-19073164 TAGGACAAGATGTCAAGGAATGG - Intergenic
928262236 2:29778365-29778387 TTGGACCAGGCTCCAAGGAAGGG + Intronic
928793096 2:34982123-34982145 TTTGAGTAGATATCAAGTAATGG + Intergenic
930966212 2:57330997-57331019 TTTGAACAGTTTTGTAGGAAAGG - Intergenic
931885633 2:66614523-66614545 TTTGAACTCATTGCAAGGAAGGG - Intergenic
932751173 2:74372624-74372646 TTTGACCAGTTTTGATGGGAGGG - Intronic
937091820 2:119211633-119211655 TTTGATGAGATTTCTAGGGAGGG + Intergenic
937152925 2:119698241-119698263 TTTGATGAGATTCCTAGGAAGGG + Intergenic
937314032 2:120919780-120919802 CATGACCAGAAATCAAGGAAGGG - Intronic
938744410 2:134263331-134263353 TTTTACCAGATTTCGATGCATGG + Intronic
939835110 2:147120456-147120478 TTTAAGCAGATTTCTAGGCATGG - Intergenic
939937015 2:148305102-148305124 TTTGATCAGATATCAAGGATGGG + Intronic
940031470 2:149267010-149267032 TTTGAACAGATCACAAGTAAGGG - Intergenic
943924748 2:193759762-193759784 ATTCACCATGTTTCAAGGAAGGG - Intergenic
944627300 2:201584425-201584447 GTTAACCAGAGTCCAAGGAAAGG + Intronic
947882849 2:233535069-233535091 ATGGAACAGATTTCAAGAAAAGG + Intronic
1170140307 20:13119264-13119286 TTTGACAACATTTCAAGAATTGG - Intronic
1172590427 20:36113752-36113774 TTTGCCCAAATGTCAGGGAAAGG - Intronic
1172907620 20:38380607-38380629 TTTGATGAGATTCCTAGGAAGGG + Intergenic
1172907978 20:38383455-38383477 TTTGATGAGATTCCTAGGAAGGG + Intergenic
1174582414 20:51581364-51581386 AATGACCAGGATTCAAGGAAGGG - Intergenic
1176958367 21:15131878-15131900 TTTTAACAAATTTCAAGGGAGGG + Intergenic
1179477081 21:41653853-41653875 TTTGAGCAGAGCTCAAAGAAAGG - Intergenic
1181783130 22:25207308-25207330 ATTGAGCAGATTCCAGGGAAGGG - Exonic
1181891851 22:26070200-26070222 TGTGACTAGATATCAAGGGAAGG - Intergenic
949761197 3:7472684-7472706 TTTGACCAGATTTCTGGAAGTGG - Intronic
949906197 3:8860639-8860661 TTTTACCTTATTTCTAGGAAAGG + Intronic
950294724 3:11818992-11819014 TTTGAGCAGATTTTTAGGACTGG - Intronic
951087690 3:18533345-18533367 TTTAAATAGACTTCAAGGAAGGG - Intergenic
953030984 3:39179706-39179728 TCTGCCCAGATTGAAAGGAAGGG - Intergenic
955301262 3:57782129-57782151 TATGACCAAATCTCAAGAAATGG - Intronic
955835185 3:63046920-63046942 TTTGACCTAACTTCAAGTAAAGG + Intergenic
956237607 3:67091763-67091785 TTTGACCAGACTACAAAGTAGGG + Intergenic
956507429 3:69957503-69957525 CTTTCCCAGGTTTCAAGGAAAGG + Intronic
956876852 3:73472230-73472252 TATGGGCAGATTTGAAGGAAAGG - Intronic
958679155 3:97304315-97304337 TTGTGCCAGTTTTCAAGGAAAGG + Intronic
958720459 3:97837236-97837258 TTTGATCACATTTTAAGGGAAGG + Intronic
959480258 3:106864211-106864233 TTTGATCAGATACCAAGGATGGG + Intergenic
962060547 3:131922526-131922548 TATGACCAGTTATCAAAGAATGG + Intronic
964263201 3:154864208-154864230 TTCATCCAGGTTTCAAGGAATGG - Intergenic
964680088 3:159328793-159328815 TGTGATCAGATTTCTATGAATGG + Intronic
964941537 3:162162770-162162792 TGTTACCAGATATAAAGGAAAGG - Intergenic
965364540 3:167782701-167782723 TTTGCCAAGATTTCAAAGGAGGG + Intronic
969861203 4:10036748-10036770 TTAGCACAGATTTCAAGAAATGG + Intronic
971599931 4:28580006-28580028 TTTCAAAAGATTTCAAAGAATGG + Intergenic
971942162 4:33229311-33229333 TTTAACCAGTTTTCAAACAAGGG + Intergenic
972319626 4:37961543-37961565 TTTGTACAGAATTCAAGGCATGG - Intronic
972403564 4:38726626-38726648 TTTGATAAGGGTTCAAGGAAAGG - Intergenic
972927904 4:44034964-44034986 GTTGTCCAGATTTCAAGTCAAGG + Intergenic
973148597 4:46860550-46860572 ATTCACCAGATGTCAAAGAAGGG - Intronic
973536116 4:51884172-51884194 TTTGGCCAGATTATGAGGAAGGG + Intronic
973649837 4:52987548-52987570 TTTAAACAGAGTTCATGGAAAGG + Intronic
973752068 4:54031156-54031178 TTTGCTCAGATTAAAAGGAAAGG + Intronic
974072356 4:57135884-57135906 ATTCACCAGTTTTTAAGGAAAGG + Intergenic
975481491 4:74885556-74885578 TTTGATCAGATATCAAGGGTGGG + Intergenic
976476379 4:85488303-85488325 TTTCACCAAATTTATAGGAAAGG - Intronic
977123808 4:93138864-93138886 TGTGACCCGATTTCAGGTAAAGG - Intronic
977870917 4:102089543-102089565 TATGACCAGTTATCTAGGAAAGG - Intergenic
978139905 4:105306699-105306721 TTTGACCCCATTTCCAGGATAGG - Intergenic
980743953 4:136991242-136991264 TTTCAGCAAATTTCAAGGTATGG - Intergenic
980920150 4:139076205-139076227 TTTGAACAGATTTCCATAAATGG - Intronic
981045386 4:140259984-140260006 TTTGACCCAACCTCAAGGAATGG - Intronic
983206450 4:164915446-164915468 GTTGATCAGATTTCAAGGTCTGG + Intergenic
983212174 4:164970100-164970122 GTTGATCAGATTTCAAGGTCTGG - Exonic
984218215 4:176941033-176941055 TTTGGCCATCTTTGAAGGAAGGG + Intergenic
984734395 4:183097636-183097658 TTGGAACAGACTTCACGGAAGGG - Intergenic
986513912 5:8541083-8541105 TTTCACAATATTTTAAGGAAAGG - Intergenic
986954309 5:13132353-13132375 TTTGACCAAAATGGAAGGAAGGG - Intergenic
987949907 5:24661162-24661184 TTTGATGAGATTTCTAGGGATGG - Intergenic
989288588 5:39733647-39733669 TTTGACAAGATTTAAATGAATGG + Intergenic
992480407 5:77145924-77145946 TTTGATTAGATTTCAAGGGCTGG - Intergenic
994903089 5:105801681-105801703 TTTGATGAGATTTCTAGGGAGGG - Intergenic
996244460 5:121244087-121244109 TTGGCCCGGATTTCAAGAAAAGG + Intergenic
997446649 5:133945197-133945219 ATGGACCAGATTTTAAGAAAAGG - Intergenic
997451245 5:133985315-133985337 TTTGGCAAGGTTTGAAGGAAAGG + Intronic
997619763 5:135279125-135279147 TTTGACCATATTTAAAGATAGGG - Intronic
999081602 5:148849392-148849414 TGTGACCATATTTAAAGGTAGGG - Intergenic
999214608 5:149921740-149921762 TTTGAAAAGAGATCAAGGAAAGG + Intronic
1000770934 5:165352971-165352993 ACTGACCAAAGTTCAAGGAAAGG + Intergenic
1002878151 6:1229200-1229222 TGTCACCAGATTACAAGCAAGGG + Intergenic
1005894114 6:30163609-30163631 TGTGACTCGATTTCAGGGAAAGG + Exonic
1007088790 6:39169096-39169118 CTGGACCAGACTGCAAGGAAGGG - Intergenic
1007163083 6:39808653-39808675 TCAGACCAGATTTCAAGGGAAGG - Intronic
1008423537 6:51330744-51330766 TTTGACCTGACTTCTAAGAAAGG - Intergenic
1009569246 6:65360982-65361004 TGTGACTGGAGTTCAAGGAATGG + Intronic
1009707249 6:67267227-67267249 TTTGACCAAATTGGAAGTAAGGG + Intergenic
1011121536 6:83959010-83959032 ATTCACCAGTTTTCAAAGAAAGG - Intronic
1011757742 6:90521623-90521645 TCTAACCAGACTGCAAGGAATGG + Intronic
1012874069 6:104705223-104705245 TTTTATCAGATCTCAGGGAAAGG - Intergenic
1014810743 6:125882575-125882597 TTTTCATAGATTTCAAGGAAAGG - Intronic
1014961574 6:127692779-127692801 TTTGAGAAGGCTTCAAGGAAAGG - Intergenic
1015394967 6:132723041-132723063 TTTGACCAGATTTCAAGAGATGG - Exonic
1015552882 6:134430679-134430701 TGTGACCATATTTGAAGAAAGGG - Intergenic
1015935985 6:138406246-138406268 TTAGACCTGATTTTATGGAAGGG - Intronic
1016507794 6:144803708-144803730 TATGTCCAAATTTCAGGGAATGG - Intronic
1016731812 6:147435643-147435665 TTTGAGAAGATTTTAAGGAAAGG - Intergenic
1017561035 6:155628110-155628132 TTTGAGGAGAATTCAAGGGAGGG - Intergenic
1022083852 7:27048011-27048033 TTTGACAAATTTTCAATGAAAGG + Intergenic
1024389714 7:48794278-48794300 TTTGATTAGATATCAAGGATGGG + Intergenic
1024714584 7:52061693-52061715 TTTGATAAGATTTCTAAGAAAGG - Intergenic
1027812861 7:82927589-82927611 TTTGCCAGGATTTCAAGGATCGG + Intronic
1029718833 7:102349664-102349686 GGTGAACTGATTTCAAGGAATGG + Intergenic
1029753782 7:102559593-102559615 GGTGAACTGATTTCAAGGAATGG - Intronic
1029771731 7:102658680-102658702 GGTGAACTGATTTCAAGGAATGG - Intronic
1030092625 7:105871221-105871243 TTTGCCCATATTTAAAGAAAGGG - Intronic
1033053295 7:138026792-138026814 TTCGCCCTGATTTCAAGGATAGG + Intronic
1033346390 7:140528438-140528460 TTTGACCAGAATTCTGGGTAAGG - Intronic
1035241481 7:157533466-157533488 GGTGACCAGATATCAAGGATGGG - Intergenic
1035820851 8:2589781-2589803 TTTGATCAGATATCAAGGGTGGG - Intergenic
1037024556 8:14018000-14018022 TTTCATCAGATTTCAAAGAGAGG - Intergenic
1037122237 8:15302608-15302630 GTTAACCAGAATTCAAGAAAGGG + Intergenic
1039564543 8:38541331-38541353 TTTGATGAGATTCCTAGGAAGGG + Intergenic
1041125178 8:54629953-54629975 TTCAACCAGATTTGAAGGAAAGG + Exonic
1041742348 8:61169408-61169430 TTTGATAAGATTTCTAGGGAGGG - Intronic
1043287694 8:78554683-78554705 TTTCACCAGCTTTCTAAGAAAGG + Intronic
1043415200 8:80040692-80040714 TTGGGGCAGATTTCAAGGAAAGG + Intronic
1045824533 8:106381404-106381426 TTTGAGCATGTTTGAAGGAATGG + Intronic
1046000762 8:108418739-108418761 TTTGAAAAGATTTAAAGAAATGG - Intronic
1048235069 8:132681974-132681996 TTTGCCAAGATTTAAAGGGATGG + Intergenic
1048660126 8:136590025-136590047 TTTGATCAGATTCTAATGAATGG + Intergenic
1051122550 9:13767472-13767494 TTTGACCAATTTTTAAGTAAAGG - Intergenic
1051494176 9:17700271-17700293 TCTTACCATATTTGAAGGAATGG + Intronic
1052184287 9:25572199-25572221 TTTGACCAGAAATCAATGTAAGG - Intergenic
1052211928 9:25914484-25914506 TTTTACCAAATTTAAAGAAAAGG + Intergenic
1052397876 9:27962849-27962871 TTTGATCAGAATTAATGGAAAGG - Intronic
1052481943 9:29041284-29041306 TTCTACCAAAATTCAAGGAAGGG + Intergenic
1052742620 9:32408108-32408130 TTTGACCAGATTTCAAGGAATGG - Intronic
1053842784 9:42203242-42203264 TTGGAGAAGATTTGAAGGAAAGG - Intergenic
1054586504 9:66972880-66972902 TTGGAGAAGATTTGAAGGAAAGG + Intergenic
1055523991 9:77111432-77111454 TTTAACAAGATTTCTAGGGAAGG - Intergenic
1056371808 9:85963240-85963262 TTTGTCCATATTTGAAGGTATGG + Intronic
1056978021 9:91278563-91278585 TTTGGCGCGATTTCAACGAATGG + Intronic
1058091083 9:100806219-100806241 TGTGATCAGATTCCAATGAATGG + Intergenic
1058328311 9:103726072-103726094 ATTGATCAGATATCAAGGATGGG + Intergenic
1058733288 9:107870514-107870536 TTTAACCAGATTTTAAGTCATGG + Intergenic
1059503066 9:114772450-114772472 TTTCACCAGAGTTCGAGGCAAGG + Intergenic
1059602210 9:115791240-115791262 TTTGACCATCTTTCAAGGCATGG + Intergenic
1059826358 9:118033633-118033655 TTTGATCAGATACCAAGGATGGG - Intergenic
1059867840 9:118536367-118536389 ACTGAGCACATTTCAAGGAACGG - Intergenic
1186359501 X:8825055-8825077 TTTGAACAGATTTGAAGGGAGGG - Intergenic
1188811766 X:34659910-34659932 TTTGATGAGATTTCAAGGGAAGG + Intergenic
1189882548 X:45507451-45507473 TCTGCCCTGATTTCCAGGAAAGG - Intergenic
1190712413 X:53080222-53080244 TTTGACCAAATTTAGAGGGAGGG + Exonic
1193213064 X:78830252-78830274 TTCTACCAGTTTTCAGGGAATGG + Intergenic
1194051138 X:89070555-89070577 TTTTACCATATTTCCTGGAATGG - Intergenic
1194355080 X:92873210-92873232 TTTGACCATACTTCATGGGAAGG + Intergenic
1195252003 X:103058042-103058064 TTTTAGAAGATTTTAAGGAAAGG - Intergenic
1195995514 X:110727934-110727956 TTTAACCAGATTTCTATCAATGG - Intronic
1196111189 X:111948923-111948945 TTTGATTAGATTTCTAGGGAGGG - Intronic
1196130533 X:112150509-112150531 TTTCAGCAGATTTAAAGGGAAGG - Intergenic
1196403487 X:115340378-115340400 TTTGTCTACATTTCAAAGAAAGG - Intergenic
1197087134 X:122491993-122492015 TTTGAGTAGATATCTAGGAAGGG + Intergenic
1198567336 X:137917690-137917712 TTTAACAAAATTTCAGGGAAGGG - Intergenic
1198576367 X:138014227-138014249 TTTGTCGACATTTCAATGAATGG - Intergenic
1200041181 X:153370836-153370858 TTTGAGGAGAGTTCAAGAAATGG - Intergenic
1200663440 Y:5990229-5990251 TTTGACCACACTTCATGGGAAGG + Intergenic