ID: 1052743485

View in Genome Browser
Species Human (GRCh38)
Location 9:32416435-32416457
Sequence AGACACTCCTTGGGAAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 329}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052743485_1052743489 -8 Left 1052743485 9:32416435-32416457 CCCTTTTTTCCCAAGGAGTGTCT 0: 1
1: 0
2: 1
3: 35
4: 329
Right 1052743489 9:32416450-32416472 GAGTGTCTGCCCATCTTGCTCGG No data
1052743485_1052743490 -7 Left 1052743485 9:32416435-32416457 CCCTTTTTTCCCAAGGAGTGTCT 0: 1
1: 0
2: 1
3: 35
4: 329
Right 1052743490 9:32416451-32416473 AGTGTCTGCCCATCTTGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052743485 Original CRISPR AGACACTCCTTGGGAAAAAA GGG (reversed) Intronic
907403395 1:54239479-54239501 AGACACTGCCTGGGACAACATGG + Intronic
908031110 1:60000917-60000939 AGACTCTCCTTGGGCAAAGAAGG - Intronic
909023592 1:70459414-70459436 AGACACTTCTGGGAACAAAAAGG + Intergenic
910896969 1:92079906-92079928 AGCCACTCCTTGGATAAGAAGGG + Intergenic
910919131 1:92324845-92324867 AGAGACTTATTGGGAAATAATGG + Intronic
910989835 1:93044022-93044044 AGAAACTCCTTAGAAATAAAAGG + Intergenic
911172057 1:94780470-94780492 AGACACTCCTTAGGTAGAGATGG - Intergenic
911241393 1:95471173-95471195 AGACACACATTGGGCCAAAAAGG - Intergenic
912316381 1:108670792-108670814 AGACATACCTTGGGCCAAAAGGG + Intergenic
913433675 1:118824606-118824628 AGACATTTCTTCAGAAAAAAAGG - Intergenic
915849799 1:159309409-159309431 AAACATTCCTTGGAAAAAATGGG - Intergenic
916446332 1:164875619-164875641 AGTCCCACCTTGGGCAAAAATGG + Intronic
916973047 1:170044711-170044733 AGTCAGTCCTGGGGAAAAAGAGG - Intronic
917602710 1:176594023-176594045 TGACACTCATGGGGAAAACAAGG - Intronic
918438875 1:184545841-184545863 AGAGCCTGCTTGGGAATAAAGGG - Intronic
918446458 1:184622091-184622113 AGATACACGTGGGGAAAAAAAGG - Exonic
919071212 1:192757203-192757225 ACACAACCCTTGGGCAAAAAGGG - Intergenic
919156228 1:193769421-193769443 AGAAACTTCCTAGGAAAAAAAGG - Intergenic
919478117 1:198054261-198054283 AGACACACCCTGGGCCAAAAGGG - Intergenic
919967364 1:202541476-202541498 TGTGGCTCCTTGGGAAAAAAAGG - Intronic
920953680 1:210598089-210598111 AGACACACCCTGGGCCAAAAGGG - Intronic
920988122 1:210909627-210909649 AGACAGTCCCTGGGATCAAAAGG - Intronic
921284579 1:213597579-213597601 AGATATTCCTTGGGAAAGGAAGG + Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921863288 1:220061956-220061978 AGAGGGTCCTTGGGAAAATAAGG + Intronic
922336199 1:224619997-224620019 AGACATCCAGTGGGAAAAAAGGG - Intronic
922579929 1:226689360-226689382 GGACACTCTCTGGGAAACAAAGG - Intronic
923336437 1:232975013-232975035 ACACACTCATTGGGATACAATGG - Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924898898 1:248373377-248373399 AGACACTCCTTGGGCCAAAAGGG - Intergenic
1067032645 10:42888670-42888692 AGACACACCTTGGGCCAGAAAGG - Intergenic
1067143206 10:43673450-43673472 AGACAGACCTTGGGGAGAAAAGG - Intergenic
1067535681 10:47108100-47108122 AGACACTACTTGGGAATCTATGG + Intergenic
1068790779 10:61028979-61029001 AGACACTCCTTGGTGAGATACGG + Intergenic
1068901592 10:62275466-62275488 AGATACTCCTCAGGAGAAAAAGG - Intergenic
1069598779 10:69689691-69689713 AGACTCCCCTTGGGGAAAACTGG + Intronic
1070058044 10:72954128-72954150 AGGCAGTTCTTAGGAAAAAAGGG - Intronic
1070059429 10:72967829-72967851 AGACACACCCTGGGCCAAAAGGG - Intergenic
1070359029 10:75669293-75669315 AGAACCTCATAGGGAAAAAATGG - Intronic
1071211861 10:83350917-83350939 AGACACTTCTTTCAAAAAAATGG + Intergenic
1071326188 10:84520730-84520752 AGAGACTCCATGGCAAGAAATGG - Intergenic
1072083575 10:92056961-92056983 AGACACACCTTGGGCCAGAAGGG + Intronic
1073366339 10:102945259-102945281 AAACACTCCTCTGGAAAATAAGG - Intronic
1073854284 10:107656840-107656862 TGACCCTTCTTGGAAAAAAATGG - Intergenic
1074026953 10:109646020-109646042 AGACATTCCCTTGGAAAAAAAGG + Intergenic
1074442994 10:113495075-113495097 AGACCCTTCTTGAGAAAGAAGGG + Intergenic
1074731702 10:116384948-116384970 CTACACTCCTTGAGAAGAAAGGG + Intergenic
1078992606 11:16664934-16664956 AGACACACCTTGGGCCAGAAGGG + Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081487911 11:43546296-43546318 CGACACTCCTTGGGGAAGAAAGG - Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083104085 11:60340823-60340845 ATTGACTTCTTGGGAAAAAACGG + Exonic
1083728006 11:64638297-64638319 AGACACTTCTTGGGCAGAAGAGG + Intronic
1084048263 11:66583469-66583491 AGACAATCATGGGGAAAGAAAGG - Intergenic
1084572110 11:69966089-69966111 TGACACTGCTTGGGAAACAAAGG + Intergenic
1085089610 11:73699481-73699503 AGACCAGCCTTGGCAAAAAAGGG - Intronic
1085449423 11:76623003-76623025 AGAGACACCTTTGGAAAATATGG + Intergenic
1086010406 11:82096208-82096230 AGACAATCCTTGCGCAAATAAGG + Intergenic
1086468227 11:87076794-87076816 AGACATACCTTGGGCCAAAAGGG - Intronic
1086849295 11:91790618-91790640 AGGCACTGTCTGGGAAAAAAGGG + Intergenic
1086875051 11:92085642-92085664 AGAAATTCTTGGGGAAAAAATGG + Intergenic
1088881206 11:113974986-113975008 AGTTACTCCTTGGGGAAACATGG + Intronic
1091631755 12:2166808-2166830 AGACTCACCTTGGGAAAAGTGGG + Intronic
1092317464 12:7433214-7433236 AGACATTACTTTGGAAATAAGGG + Intronic
1092801976 12:12177362-12177384 ATACACTTCTTGGAAAAAGAGGG + Intronic
1093310327 12:17574292-17574314 GGACACTACTGGGGAAAAAAAGG + Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094409342 12:30152164-30152186 AGACACTCCTTAGTAAACACTGG + Intergenic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1095353019 12:41237173-41237195 AGGCACTTCTTGGGAAAAATGGG + Intronic
1095959759 12:47826885-47826907 AGACACTCCTGGGGAAAGAGAGG - Intronic
1097471593 12:59999667-59999689 AAAAACCCCTTGGAAAAAAATGG - Intergenic
1097473275 12:60021875-60021897 AGACACACCCTGGGACAGAAGGG - Intergenic
1098042333 12:66364931-66364953 GGACACGCCCTGGGGAAAAAGGG - Intronic
1098158100 12:67621232-67621254 AGACATTGATTGGGAAAGAATGG + Intergenic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1098666733 12:73172801-73172823 AGAAACTCCTGAGGATAAAAGGG + Intergenic
1099106621 12:78505336-78505358 GAACACTGCTTAGGAAAAAAAGG - Intergenic
1100362501 12:93891473-93891495 CGACACTCCGTGTCAAAAAAAGG + Intronic
1100433092 12:94547582-94547604 AGACATTCCCTGGGTCAAAATGG - Intergenic
1100969815 12:100056385-100056407 AGACATTGCTTGGCAATAAATGG + Intronic
1101226633 12:102694265-102694287 AGACACACCATGGGCTAAAAGGG + Intergenic
1104310611 12:127651250-127651272 AGACACTCCATGGGCACAACAGG + Intergenic
1105906798 13:24819947-24819969 AGACAGTCCTAGGTAAACAAGGG - Intronic
1109135907 13:58650329-58650351 ACACACTCTGTGTGAAAAAAAGG - Intergenic
1110308236 13:74015751-74015773 AGACCTACCTTGGGAAGAAAGGG - Intronic
1110641105 13:77825195-77825217 AGACTCTCATTGGCCAAAAATGG + Intergenic
1111365257 13:87234770-87234792 AGACACACCCTGGGCCAAAAGGG - Intergenic
1112124209 13:96446943-96446965 AGGCACACCTAGGGAAAAAGAGG - Intronic
1112277957 13:98038231-98038253 AGACAGAGCGTGGGAAAAAAAGG + Intergenic
1112534910 13:100243440-100243462 AGAGATACCTGGGGAAAAAAAGG + Intronic
1112719141 13:102222915-102222937 AGACCCTACTTAGGAGAAAATGG + Intronic
1113132339 13:107051864-107051886 AGTCAGTCCTAGGGAAAAAGAGG - Intergenic
1115631284 14:35248243-35248265 TGAATCTCTTTGGGAAAAAATGG - Intronic
1116354781 14:43914550-43914572 AGACATTCCTTGGGGCAAAAGGG + Intergenic
1117384296 14:55195277-55195299 AGACACACCTTGGGCCAAAAGGG - Intergenic
1117470424 14:56039098-56039120 AGAATCTCCTTGGGAAAGATGGG - Intergenic
1117843055 14:59880972-59880994 AGACACACCTTGGGCCAGAAGGG - Intergenic
1119258384 14:73219972-73219994 AGACTGGCCTTGGGAAGAAATGG - Exonic
1120138568 14:80900881-80900903 GGATACCCCTTGGGAAAAGATGG + Intronic
1120273722 14:82346991-82347013 AAAGTCTCCTTGGGAGAAAAGGG - Intergenic
1121400187 14:93669369-93669391 AAACACTCCCTGGGTAAAAATGG - Intronic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1124044267 15:26134092-26134114 AAAGACTCCTTGGAAACAAATGG + Intergenic
1124910091 15:33911291-33911313 AGACACCCCTTGAGGAACAAAGG + Intronic
1125390597 15:39188538-39188560 AGACCTTCTTTGGAAAAAAATGG - Intergenic
1125621824 15:41069842-41069864 AGACACACCTGAGAAAAAAATGG + Intronic
1127173458 15:56328222-56328244 AGACACACCCTGGGCCAAAACGG + Intronic
1127313576 15:57773851-57773873 AGACACTACTTGGTAAACGACGG - Intronic
1128003578 15:64217238-64217260 AGAGACTCCCTGTGAAAAGAGGG - Intronic
1128810535 15:70568650-70568672 AGACACTGCTTCGGAGAACAGGG - Intergenic
1129222616 15:74140461-74140483 AGACATTCCATAGGGAAAAAGGG + Intergenic
1129835566 15:78703260-78703282 AGACACACCCTGGGCCAAAAGGG - Intronic
1130082310 15:80744674-80744696 AGTGACTTGTTGGGAAAAAAGGG - Intronic
1130653704 15:85777177-85777199 AGACAATGCTTGGTAATAAACGG + Intronic
1131593648 15:93774642-93774664 AGAGACTTCTTGGGAGACAATGG - Intergenic
1131755154 15:95551514-95551536 TGAAACTCTTTGGGAAGAAAAGG + Intergenic
1132257083 15:100385037-100385059 AGGCACTCCTTAGGAAAGAGAGG - Intergenic
1133972673 16:10578901-10578923 AGACCCTTCTGGGGAAAACAGGG - Intronic
1135740408 16:24970352-24970374 TGAGACTCCTTGGGAGAAAGTGG - Intronic
1138396450 16:56708444-56708466 AGACAATTGTTGGGAAAGAAAGG + Intronic
1138844975 16:60554434-60554456 AGACACACCCTGGGCCAAAAGGG - Intergenic
1141714547 16:85719242-85719264 AGACACTGCTGCGGAAAGAACGG + Intronic
1142057262 16:88005918-88005940 AGAAACTCCATGGGAGAAAATGG - Intronic
1142837224 17:2595397-2595419 AAACACTCCTGTGGCAAAAAGGG - Intronic
1143501538 17:7342260-7342282 AGACACTCCTAGGCAAGAAGAGG - Exonic
1143940084 17:10531518-10531540 AGACACTCATTGGAAGGAAAAGG - Intronic
1146824890 17:36013560-36013582 AGACACTCCCAGGGGGAAAAGGG - Intronic
1148249715 17:46065871-46065893 AGACCCTGCCTGAGAAAAAAAGG - Intronic
1149171698 17:53819895-53819917 AGACACCCCTTCTGAAGAAATGG - Intergenic
1149900108 17:60468314-60468336 AAAAAGTCCTTGAGAAAAAAAGG + Intronic
1150372664 17:64654118-64654140 AGAAACTTTTTGGGAAGAAATGG + Intronic
1151921593 17:77160665-77160687 AGACACTAGTTAGAAAAAAATGG - Intronic
1153075350 18:1156261-1156283 AGACACACCCTGGGACAGAAAGG - Intergenic
1153429424 18:4999667-4999689 AGACACACCCTGGGCTAAAAGGG + Intergenic
1154040347 18:10848969-10848991 AGACACTTCTTGACAAAAAGAGG - Intronic
1155131927 18:22944292-22944314 AGAAAATCCTTGGGAAACAGGGG - Intronic
1156323013 18:36045867-36045889 ATAAACTGCATGGGAAAAAAGGG + Intronic
1157259635 18:46167010-46167032 AGACACTGTTTTGGAAGAAAGGG - Intergenic
1157708254 18:49827412-49827434 AGACATTCCTTGGGATGCAATGG + Intronic
1157762009 18:50272373-50272395 AGAAATTCCTTAGGAAAATAGGG + Intronic
1161092078 19:2366064-2366086 TGAAACTGCTTGGAAAAAAAGGG + Intergenic
1162666806 19:12220439-12220461 AGACACACCTTGGGCCAGAAGGG - Intergenic
1163380064 19:16960117-16960139 AGGCACTCCTTAGGAAACAGAGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1167221432 19:48201393-48201415 AGACAGTCGTAGGGAAAGAAAGG - Intronic
1167582223 19:50351903-50351925 AGACACACCTTGGGCGAGAAGGG - Intronic
1167658095 19:50779474-50779496 TGACAATCCATGGGAAGAAATGG + Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925125552 2:1453393-1453415 AGACCCTCCTTCGGAAAACAGGG + Intronic
926325798 2:11784521-11784543 AGACCCTCCTGGGGGAAAAAAGG - Intronic
926602005 2:14855156-14855178 AGACACACCCTGGGACAGAAAGG + Intergenic
927705964 2:25296768-25296790 AGACAGTCCTTGGGGGCAAAAGG + Intronic
928833902 2:35521019-35521041 AGGAACTCCTTGGGAAAAGCAGG - Intergenic
929036660 2:37699657-37699679 AGCCCCTTCTTGGGAAAAACAGG - Intronic
929054749 2:37866360-37866382 TGACACTCCTAGAGAACAAATGG - Intergenic
930439704 2:51390679-51390701 AGACACACCCTGGGCCAAAAGGG - Intergenic
931012207 2:57929822-57929844 AGACACTCCCTGGGCCAAAAAGG - Intronic
931564101 2:63595728-63595750 ACACACACATTGGGGAAAAAAGG - Intronic
933162836 2:79044912-79044934 AGACACACCCTGGGTCAAAAGGG + Intergenic
933576886 2:84079694-84079716 AGACACACCTTGGGCCAGAAGGG - Intergenic
934538352 2:95155423-95155445 AGACACTCCTTTGCAGAAGAGGG - Intronic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
935440918 2:103094614-103094636 AGACACTCCAAAGGAAACAATGG + Intergenic
936647182 2:114385361-114385383 AGACAGTCCTTAGGAAAGAGAGG + Intergenic
937308903 2:120889317-120889339 AGACACACCTTGGGTAGTAAAGG + Intronic
937859723 2:126698199-126698221 AGACACTCATTGGGGTGAAAAGG + Intergenic
939401090 2:141694677-141694699 AGACATCACTTGGGAACAAATGG + Intronic
939442521 2:142267803-142267825 ATAGACTCCTTGGCAAAAATAGG + Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942438816 2:176009993-176010015 AGATAGTACTTGGGAAAAGAAGG + Intergenic
942676117 2:178428335-178428357 GGACCCTGATTGGGAAAAAATGG - Intergenic
944000591 2:194831611-194831633 ATACACTACTTTGGATAAAACGG - Intergenic
945210202 2:207374975-207374997 AGACACACCCTGGGACACAAGGG + Intergenic
945988520 2:216373338-216373360 AGAAACTCCTTGAGAAAAATAGG - Intergenic
946523504 2:220492831-220492853 GGTCATTCCTTGGGAAAACAGGG - Intergenic
948160884 2:235823103-235823125 AGAAACTACTTGGAAAAAATAGG - Intronic
1169466171 20:5841804-5841826 AAACACTCTTTTGGAAAAAAGGG - Intronic
1169624312 20:7546513-7546535 AAACACTCAATAGGAAAAAAAGG + Intergenic
1171518624 20:25759152-25759174 AGACAGACCTAGGGGAAAAAAGG + Intergenic
1171558232 20:26097057-26097079 AGACAGACCTAGGGGAAAAAAGG - Intergenic
1172203622 20:33146120-33146142 AGACACACCTTGGGCCAGAAGGG - Intergenic
1172531963 20:35637586-35637608 AGAAAATCCTTGGGGAAAACAGG - Intronic
1173334057 20:42098885-42098907 AGACACCTCTTGGGATATAAGGG + Intronic
1178063215 21:28874721-28874743 AGACACTGAATGGGCAAAAAGGG - Exonic
1178093864 21:29193278-29193300 GGACACTCCATCGGAAAAAAGGG + Intergenic
1178364066 21:31973881-31973903 ATAAACTCCTTGGGATAAAATGG - Intronic
1179295607 21:40059596-40059618 AGATACTTCTTGGTAGAAAATGG + Intronic
1181793654 22:25287174-25287196 ATAGACTCATTGGGAAGAAAAGG - Intergenic
1182405635 22:30127042-30127064 AGACAATCCAAGAGAAAAAAAGG - Intronic
1182483736 22:30626815-30626837 TCAGACTCCTTGGCAAAAAACGG + Exonic
1184322868 22:43756496-43756518 AGCCCCTCCTTGGGACAAACTGG + Intronic
951125878 3:18982850-18982872 AGACACACCCTGGGACAGAAGGG - Intergenic
951904274 3:27688578-27688600 AGACACACCTTGGGTTAGAAGGG + Intergenic
952930705 3:38358768-38358790 AGATACTACTAGGGAAAAAGAGG - Intronic
953435651 3:42875165-42875187 AGACAAACCTTGGGAAAAGAAGG + Exonic
953681176 3:45039438-45039460 AGACCCTCCGTGTGAAGAAAGGG + Intergenic
953992646 3:47496084-47496106 AGACATTCCTTTGGCAAAAAAGG + Exonic
954092541 3:48296542-48296564 GAACCCTCCTTGGGAAAAGATGG + Intronic
957662041 3:83170212-83170234 AGAAATTCTTGGGGAAAAAAAGG + Intergenic
957900355 3:86481368-86481390 AGACACACCTTGGGCCAGAAGGG - Intergenic
958125973 3:89355421-89355443 AAATATGCCTTGGGAAAAAAAGG + Intronic
958179068 3:90034241-90034263 GTAAACTACTTGGGAAAAAAAGG + Intergenic
958485499 3:94702281-94702303 AGACAGTCCTTGGGATACACTGG + Intergenic
958659519 3:97048337-97048359 AGACACTGCATGTGAACAAAAGG + Intronic
958689969 3:97451797-97451819 AGGCACTACTTGAGAAACAAAGG - Intronic
959215727 3:103448171-103448193 AGACACACCCTGGGACAAAAGGG + Intergenic
959570415 3:107877127-107877149 AAATTCTCCTTGAGAAAAAAAGG + Intergenic
960404111 3:117238577-117238599 AGACACACCCTGGGCCAAAAGGG + Intergenic
960541374 3:118865803-118865825 AGACACACCTTGGGCCAGAAGGG - Intergenic
960781681 3:121326253-121326275 AACCACATCTTGGGAAAAAAGGG + Intronic
960892313 3:122462431-122462453 AGACACTCTTAGGGCAAAGAAGG + Intronic
960991551 3:123314820-123314842 AGCCACTCTTTGAGAAACAAGGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961952265 3:130762356-130762378 AGACACACCCTGGGCAAGAAGGG + Intergenic
962106500 3:132395812-132395834 AGATACACCTTGGGCCAAAAGGG + Intergenic
962809981 3:138951456-138951478 ACATACTCCTTGGGACAAAATGG - Exonic
963443694 3:145374428-145374450 AGACACACCTTGGGCCAGAAGGG + Intergenic
963469771 3:145725678-145725700 AGACACTCTTTGCAAAAAGAAGG + Intergenic
963763385 3:149308081-149308103 TGACACACCTTGGGCAAAAAGGG - Intergenic
964075478 3:152686807-152686829 AGACATTCTTTGGGAAAGAATGG - Intergenic
964804061 3:160587564-160587586 AGACACACCTTGGGCCAGAAGGG + Intergenic
964827443 3:160844337-160844359 AGAGATTCCATGGGCAAAAAGGG + Intronic
965358667 3:167709969-167709991 AGACACACCCTGGGCCAAAATGG + Intronic
965518533 3:169648828-169648850 AGACACACCTTTGGAAACCATGG + Intronic
965732251 3:171784575-171784597 AGACATTCTTTGGGAAGAATGGG - Intronic
965860747 3:173146829-173146851 AGACACACCCTGGGAAAGAAGGG + Intergenic
966268244 3:178072438-178072460 AGACACTAGTTGGGAAGCAATGG + Intergenic
967591704 3:191284331-191284353 AGAGACTCCTTCTTAAAAAAAGG - Intronic
967696999 3:192543773-192543795 AGACACACCCTGGGCCAAAAGGG - Intronic
968334386 3:197900826-197900848 AGACACACCTTGGGCCAGAAGGG + Intronic
971148393 4:24004974-24004996 GGAAAGCCCTTGGGAAAAAAGGG - Intergenic
973867371 4:55126930-55126952 AGAATCTGCTTGGAAAAAAAAGG - Intergenic
974469628 4:62302155-62302177 AGACACACCCTGGGACAGAAGGG + Intergenic
975662096 4:76698410-76698432 TGTCATTCATTGGGAAAAAATGG - Intronic
976041053 4:80885604-80885626 AGACACACCCTGGGCCAAAAGGG + Intronic
976525604 4:86083938-86083960 AGACACACCCTGGGACAGAAGGG + Intronic
977744962 4:100535675-100535697 AGACACACCTTGGGCCAGAAAGG + Intronic
980692989 4:136320186-136320208 AGACACACCCTGGGCCAAAAAGG + Intergenic
983813329 4:172091512-172091534 AAAATCTCCTTGGGAAAAACTGG - Intronic
984106538 4:175554984-175555006 AGGCACTCTTTGACAAAAAAAGG - Intergenic
984529799 4:180902207-180902229 AGACACACCCTGGGCCAAAAGGG - Intergenic
985007688 4:185550390-185550412 AGATACTCCTGGGGAAATAAAGG + Intergenic
985023308 4:185714210-185714232 AGATACTCCTTTAGAAAGAATGG - Intronic
985814808 5:2118780-2118802 AGACTCTCCTTGGGAGGTAATGG + Intergenic
987481269 5:18461478-18461500 AGACACATGATGGGAAAAAATGG - Intergenic
987489306 5:18556260-18556282 AAACAGTCCTTTGGAAAAACTGG + Intergenic
987537369 5:19206500-19206522 AGACACACCTTGGGCCAGAAGGG + Intergenic
987631429 5:20477985-20478007 AGACACACCCTGGGTAAGAAGGG + Intronic
987873430 5:23648747-23648769 AGACACACCGTGGGCTAAAAGGG - Intergenic
988847940 5:35148386-35148408 AGCCTCTCCTAAGGAAAAAAAGG + Intronic
990046284 5:51435902-51435924 AGAAATTCCTTAGGTAAAAAAGG - Intergenic
990072374 5:51799589-51799611 AGACAACCCATTGGAAAAAATGG + Intergenic
990604606 5:57396093-57396115 AGGCCTGCCTTGGGAAAAAAAGG + Intergenic
991021918 5:61988175-61988197 TGACAAGCCTTGGGAAAAGAAGG + Intergenic
991607314 5:68416017-68416039 ACACAGTCCTTGGGGAAAGAAGG - Intergenic
993090133 5:83415418-83415440 AAACACACCTTGGGAAATATTGG + Intergenic
993519908 5:88888166-88888188 AAACACTGCTTGGAAAAATAAGG - Intronic
993926182 5:93869248-93869270 ACCCACTTCTTGGGAAGAAAGGG - Intronic
994104577 5:95932421-95932443 AGAGACACTTTGGCAAAAAAGGG + Intronic
994328368 5:98476330-98476352 AGGCACTCCTTGAGAAAGGATGG - Intergenic
995150447 5:108838425-108838447 AGACAGGCCTTGGGGAAACAAGG + Intronic
995540435 5:113180655-113180677 ATACTCTTCTTGGGCAAAAATGG - Intronic
996192585 5:120564011-120564033 AGACACACCCTGGGCCAAAAGGG - Intronic
996459502 5:123725254-123725276 AGACACACCCTGGGCCAAAAGGG + Intergenic
997749585 5:136331274-136331296 AGCCAATCCTTGGGCAAAAGTGG - Intronic
998565961 5:143216172-143216194 ACACTCTGCTGGGGAAAAAAAGG - Intronic
999477003 5:151909471-151909493 AAACACTACCTGGGAGAAAATGG - Intronic
999480502 5:151943657-151943679 AGTCAGTCAATGGGAAAAAAAGG + Intergenic
1001992644 5:176130723-176130745 AAACATTTCTTGGAAAAAAAAGG - Intronic
1002224236 5:177707426-177707448 AAACATTTCTTGGAAAAAAAAGG + Intergenic
1004821314 6:19371107-19371129 AGCTTCTCCTTGGGAAAAAAAGG + Intergenic
1005157100 6:22819491-22819513 AGACACACCTTGGGCCAAAAGGG - Intergenic
1007000126 6:38303696-38303718 TCAAACTCTTTGGGAAAAAAAGG + Intronic
1008562675 6:52737549-52737571 ACACACCCAATGGGAAAAAATGG - Intergenic
1008752863 6:54757929-54757951 AGACACACCCTGGGACAGAAGGG - Intergenic
1008909603 6:56719088-56719110 TCACACTCCTTTTGAAAAAATGG + Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1009847013 6:69146548-69146570 AGACACACCTGGGGAACAAGAGG + Intronic
1011421029 6:87173472-87173494 AGTCACTGCTTTGGAAAACAAGG + Intronic
1012486282 6:99725477-99725499 AGACACACCTTGGGCTAGAAGGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016457395 6:144245240-144245262 AGACACACCCTGGGACAGAAGGG - Intergenic
1019380633 7:720732-720754 TGAAATTCCTTGGGAAAAAGAGG - Intronic
1019485419 7:1287191-1287213 AGACACTCTTGGAGAAAAAGTGG + Intergenic
1020229326 7:6305578-6305600 AGATCCTCCCTGGAAAAAAAGGG - Intergenic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1020871713 7:13638735-13638757 AGAAACACCCTGGTAAAAAAGGG + Intergenic
1021346110 7:19530478-19530500 AGCCACTCCTGGGGGAATAAGGG + Intergenic
1022558688 7:31326664-31326686 AGACACAACTTGAGATAAAAGGG - Intergenic
1023429123 7:40070755-40070777 AAACACACATTGGGACAAAATGG + Intronic
1025157647 7:56623776-56623798 AAGCACCCCTTGGGAAAAACTGG + Intergenic
1027757879 7:82238859-82238881 AGATATTGCTTGGGAATAAACGG + Intronic
1029472239 7:100761925-100761947 AGAGACTCCATCTGAAAAAAAGG + Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1029918761 7:104239624-104239646 ATCCACACATTGGGAAAAAAGGG + Intergenic
1030716761 7:112816548-112816570 AAACATTCCTTGGAAATAAATGG - Intergenic
1031208708 7:118794445-118794467 AGTCATTTCTTGGGAAAGAAGGG + Intergenic
1031417238 7:121508878-121508900 AGACCCTACATGGGAAACAAAGG - Intergenic
1032671197 7:134083940-134083962 AGACACTTCTAGAGAAAAATTGG - Intergenic
1033525420 7:142208842-142208864 ATACAATGCTGGGGAAAAAATGG + Intronic
1034586930 7:152101969-152101991 AGCAACTATTTGGGAAAAAAAGG - Intronic
1035324187 7:158054351-158054373 GGACACTCCTCAGGAAAGAAAGG + Intronic
1036474955 8:9084699-9084721 ACAAACTCCTTGGAAAAAGAGGG - Intronic
1037677034 8:21059740-21059762 AGACTCTTCTTGGGAGAGAAAGG - Intergenic
1037848982 8:22310358-22310380 AGATACTCCCGGGGAAAAAGAGG - Intronic
1039376485 8:37039629-37039651 ACACACTGCCTGGGAAGAAAAGG + Intergenic
1040628113 8:49175490-49175512 AGACACACCGTGGGACAGAAGGG + Intergenic
1041377791 8:57220263-57220285 TGACATTCCTTCGGAAAACAGGG - Intergenic
1042162594 8:65912367-65912389 AGACACACCCTGGGAAAGAAGGG + Intergenic
1042510660 8:69607949-69607971 TGACACTCCATGGGGAACAAAGG + Intronic
1042544892 8:69942565-69942587 AGCCACTCCTGGGGAAAATCCGG + Intergenic
1042655023 8:71086475-71086497 AGAGTCACCTTGGGAAAATATGG - Intergenic
1043482214 8:80664892-80664914 AGAAACTCCTTGTGCCAAAACGG - Exonic
1044807051 8:96019063-96019085 ATACACACCTTAGCAAAAAAAGG - Intergenic
1045172570 8:99687121-99687143 AGACACACCTTGGGCCAGAAGGG - Intronic
1048247008 8:132816461-132816483 AGAAACTCTAAGGGAAAAAAAGG - Intronic
1048823291 8:138399135-138399157 AGACTGTCCCAGGGAAAAAAAGG - Intronic
1050006844 9:1140989-1141011 AGTCACTGCTTGGGAAATATGGG + Intergenic
1050248150 9:3713583-3713605 AGACACACCTTGGGCCAAAAGGG + Intergenic
1050400245 9:5245703-5245725 AGCCAGTCCTTGAGAAACAAAGG + Intergenic
1050447421 9:5739859-5739881 AGGCACTGATTGGAAAAAAATGG - Intronic
1052054847 9:23893547-23893569 AGATACTCAATGGGATAAAAAGG - Intergenic
1052433311 9:28394558-28394580 AGACATTCCTTTAGATAAAAAGG + Intronic
1052743485 9:32416435-32416457 AGACACTCCTTGGGAAAAAAGGG - Intronic
1053089925 9:35265831-35265853 AGAGACTCCATCGCAAAAAAAGG - Intronic
1053481608 9:38420414-38420436 TGACAAACCTTGGGAAAAACAGG + Intronic
1055886509 9:81069675-81069697 AGACACACCCTGGGCCAAAAGGG - Intergenic
1056180334 9:84076546-84076568 AGACACACCCTGGGCCAAAAGGG + Intergenic
1056271293 9:84950348-84950370 AGATACTCCTTGGGGAAGGAAGG + Intronic
1056424741 9:86465229-86465251 AGACACACCCTGGGCCAAAAGGG - Intergenic
1057485358 9:95478613-95478635 GGTCACTGCTTGGGAAACAAAGG + Intronic
1058330912 9:103758310-103758332 AGTCACTCATGGGGAAGAAATGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058838815 9:108885742-108885764 AGTTGTTCCTTGGGAAAAAATGG - Intronic
1059546919 9:115185531-115185553 AGACACTTGTGGGGAAAGAAAGG + Intronic
1059752385 9:117260066-117260088 AATCACACCTTGGGGAAAAAGGG - Intronic
1059900651 9:118921562-118921584 AGACACAACTTGGGCCAAAAGGG - Intergenic
1060681576 9:125569638-125569660 ACAGCCTCCTTGGGAAAAACAGG + Intronic
1186458743 X:9731504-9731526 ACAGACTCATGGGGAAAAAATGG + Intronic
1186908751 X:14139133-14139155 AGACACTCCATGAGAAAGATGGG + Intergenic
1188040591 X:25366655-25366677 AGACACACCTTGGGCCAGAAGGG - Intergenic
1188578956 X:31687053-31687075 AGACACACCCTGGGCCAAAAGGG + Intronic
1189875715 X:45433980-45434002 AGACACACCTTGGGCCAGAAAGG - Intergenic
1190614553 X:52217176-52217198 AGACACTCCCTGGGCCAGAAGGG + Intergenic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191149899 X:57209440-57209462 AGACACTCCCTGATAAAAAAGGG - Intergenic
1191234483 X:58123140-58123162 AGAGACTCCTGGCGAAAAATAGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192040481 X:67615504-67615526 AGACATTCCTAGGTAAACAAAGG + Intronic
1193886926 X:86993994-86994016 AGACATACCCTGGGCAAAAATGG + Intergenic
1193931871 X:87562663-87562685 AGACACACCCTGGGATAGAAGGG + Intronic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1194892577 X:99398405-99398427 AGACACACCATGGGCCAAAAGGG - Intergenic
1194947375 X:100085204-100085226 AGACAATTCTAGGCAAAAAAAGG + Intergenic
1196609536 X:117695613-117695635 AGACACACCTTGGGCCAGAAGGG + Intergenic
1196806826 X:119595590-119595612 GAACACTACTTGGGACAAAAAGG + Intronic
1197317042 X:124979722-124979744 AGAAAATCCATAGGAAAAAATGG + Intergenic
1198626852 X:138585416-138585438 AGATATTCCTTGGCAATAAAAGG - Intergenic
1198818108 X:140614607-140614629 AGACACACCTTGGGCCAGAAGGG - Intergenic
1199050552 X:143232156-143232178 AGACACACCCTGTGGAAAAAGGG + Intergenic
1200969751 Y:9138775-9138797 AGACACTCGTTGACAAAAAATGG - Intergenic
1202141250 Y:21725472-21725494 AGACACTCGTTGACAAAAAATGG + Intergenic
1202145615 Y:21778330-21778352 AGACACTCGTTGACAAAAAATGG - Intergenic