ID: 1052743582

View in Genome Browser
Species Human (GRCh38)
Location 9:32417102-32417124
Sequence CACTAGTCAGTGGTGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 403}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052743582 Original CRISPR CACTAGTCAGTGGTGGAACT GGG (reversed) Intronic
901071517 1:6521950-6521972 CACTTGTCAGTGGTGTAACTTGG - Exonic
901087152 1:6617892-6617914 CACTGATTAGTGGTGGAGCTTGG + Intronic
901557222 1:10041219-10041241 AACTAGTAAGTGGTAGAACCTGG + Intronic
902171357 1:14614086-14614108 CACTAGTTAGTGATGGCAGTTGG - Intronic
902881862 1:19376873-19376895 AGCTAGTAAGTGGTGGAACTGGG - Intronic
902996692 1:20230967-20230989 AACTAGTAAGTGATGGAACTGGG - Intergenic
902996976 1:20233389-20233411 AACTATTAAGTGATGGAACTGGG - Intergenic
904249225 1:29210741-29210763 CACTAGTGAGTGGTAGAGCCAGG - Intronic
904259629 1:29280967-29280989 AGCTAGTAAGTGGTGGAGCTGGG + Intronic
904269138 1:29337810-29337832 CATTAATCAGGGGTGGAAGTGGG + Intergenic
904490655 1:30857040-30857062 CACTCCCCAGTGGTGGAAGTAGG + Intergenic
904751710 1:32744718-32744740 CACAAGACAGTGGTGGAATCAGG - Intronic
904782497 1:32961423-32961445 AACTAGTAAGTGGTGGAACCAGG - Intronic
904990180 1:34586220-34586242 CTCAAGTAAGTGGTGCAACTGGG - Intergenic
905035347 1:34914548-34914570 GTCTAGTAAGTGGTGGACCTGGG - Intronic
905475663 1:38225923-38225945 AACCAGTCAGAGGTGGAGCTGGG + Intergenic
905679536 1:39858356-39858378 AACTAGTAAGTGGTAGAGCTAGG - Intronic
905807743 1:40889086-40889108 CACTAGTAAGTGGTTGGATTTGG + Intergenic
906120239 1:43384895-43384917 AGCTAGTCAGTGGTGGAAGTGGG + Intronic
906598999 1:47107276-47107298 CTCTGGTAAATGGTGGAACTAGG + Intronic
906849350 1:49231233-49231255 AACAAGTAAGTGGTAGAACTTGG + Intronic
907836764 1:58116609-58116631 AGCCAGTCAGTGGTGGAACCAGG - Intronic
907936624 1:59047547-59047569 AGCTAGTCAGTGGTGGATCTGGG + Intergenic
908520516 1:64936648-64936670 AGCTAGTAAGTGGTGGAGCTGGG - Intronic
908654335 1:66372016-66372038 AACTAGTGACTGGTGGAGCTGGG - Intronic
908977460 1:69915954-69915976 AGCTAGTGAGTGGTGGAACCAGG + Intronic
909623783 1:77693323-77693345 CACTAGTCAGTGACAGAACAAGG + Intergenic
910127434 1:83859730-83859752 CATTAGTAAGTGGTGCAGCTGGG + Intergenic
911125206 1:94334872-94334894 AACTAGTAAGGGGTGGAACCAGG - Intergenic
911184337 1:94888147-94888169 AGCTAGTCAGTGGTAGAATTGGG + Intronic
911688722 1:100807150-100807172 CAGTAATGAGTGATGGAACTAGG - Intergenic
912598890 1:110907432-110907454 CAGGAGGCAGTGGTGGAAGTTGG - Intergenic
912939948 1:114035944-114035966 CCCTAGCGAGTGGTGGAACTAGG + Intergenic
912954541 1:114145389-114145411 AACTAGTGGGTGGTGAAACTGGG + Intronic
913202236 1:116504268-116504290 TGCTAGTCAGTGGTGGAACCAGG - Intergenic
913202328 1:116504877-116504899 TGCTAGTCAGTGGTAGAACCAGG - Intergenic
914937805 1:151995151-151995173 TATTAGTCAGAGGTGGCACTTGG - Intergenic
916811543 1:168309756-168309778 CACTACTAAGAGGTAGAACTGGG - Intronic
917823093 1:178786608-178786630 CACAACTAAGTGGTGGAACTGGG + Intronic
918495045 1:185126074-185126096 AACTAGTAAGTGGTGGAGCCAGG - Intronic
918891619 1:190279553-190279575 CACTATTCATTTGTGGAACAAGG + Intronic
920016607 1:202915713-202915735 CACTAGTAAGTGGTAGAGCCAGG - Intronic
921123062 1:212153371-212153393 CACCAGTAAGTGGTTGAGCTAGG - Intergenic
921425215 1:214993526-214993548 CACTAGTAAGTGGCAGAGCTAGG + Intergenic
921772938 1:219064510-219064532 CACTAGGCAGTCTTGGTACTGGG - Intergenic
922901360 1:229139179-229139201 CAGTGGTGAGTGGTGGAACCAGG + Intergenic
923734290 1:236588387-236588409 AACTAGTAAGTGGTAGAGCTAGG - Intronic
1064152927 10:12880154-12880176 AACTAGTAAGTGATGGAGCTAGG - Intergenic
1064240742 10:13626071-13626093 GGCTAGTCAGTGGTAGAATTGGG + Intronic
1069249617 10:66251928-66251950 AACTACTAAGTGGTGGAACCAGG + Intronic
1070695168 10:78557743-78557765 CACAAGTCTCTGGTGGTACTAGG - Intergenic
1070729721 10:78818154-78818176 CCCCACTCAGTGGTGGAGCTGGG - Intergenic
1071227380 10:83546291-83546313 CACTAGTGAGTGGCAGGACTAGG + Intergenic
1071388617 10:85147356-85147378 AACTGGTGAGGGGTGGAACTAGG + Intergenic
1072739724 10:97902131-97902153 AGCTAGTCAGTGGTGGAGCCTGG - Intronic
1072791661 10:98322310-98322332 AGCTAGTCAGTGGTAGAACTTGG + Intergenic
1074122735 10:110505237-110505259 AGCTAGTCAGTGGTAGAGCTGGG - Intronic
1074264566 10:111888604-111888626 CAGCAGTGAGTGGTAGAACTGGG + Intergenic
1074607478 10:114988166-114988188 GTCTAGTCAGTGGCTGAACTAGG + Intergenic
1074900857 10:117815492-117815514 GACTAGTAAGCGGTGGAACAGGG + Intergenic
1078182795 11:9026856-9026878 AACTAGTAAGAGGTGGAACTGGG + Intronic
1078756162 11:14212528-14212550 CATGAATCAGTGGTGGAACCTGG - Intronic
1079108823 11:17592025-17592047 CAGCAGTCAGTGGTAGAGCTGGG + Intronic
1080269695 11:30437945-30437967 AACTATTAAGTGGTGGAATTAGG - Intronic
1080937368 11:36878341-36878363 CACAATTAAGTGGAGGAACTGGG + Intergenic
1081208084 11:40298408-40298430 CTATAGTCACTGGTGCAACTGGG + Intronic
1081818334 11:45966538-45966560 AGCTAGTGAGTGGTAGAACTAGG - Intronic
1082778834 11:57270385-57270407 CACCAGTAAGCGGTGGAGCTGGG - Intergenic
1082923328 11:58519600-58519622 AACTAGTAAGTGGTAGAGCTGGG + Intergenic
1083680582 11:64349927-64349949 CCCTAGGCAGTGGAGGACCTCGG - Intronic
1084786766 11:71447077-71447099 CACCAGTCAGTGTGGGAACTAGG - Intronic
1084959541 11:72709334-72709356 AGCTAGTCAGTGGTGGACCCAGG + Intronic
1084992092 11:72936067-72936089 TGCTAGTAAGTGGTAGAACTGGG - Intronic
1085108884 11:73870165-73870187 AGCTAGTCAGTGGCGTAACTAGG + Intergenic
1085724708 11:78944134-78944156 CACTAGTGAGAGGCAGAACTGGG + Intronic
1085734090 11:79024184-79024206 TCTAAGTCAGTGGTGGAACTGGG - Intronic
1085815992 11:79738099-79738121 AGCTAGTAAATGGTGGAACTGGG - Intergenic
1086056142 11:82649377-82649399 TACTAGCCAGTGGAAGAACTGGG - Intergenic
1086369966 11:86146670-86146692 AATTAGAAAGTGGTGGAACTGGG + Intergenic
1087175549 11:95091855-95091877 AGCTAGTCAGTGGAGCAACTAGG - Intronic
1088200611 11:107329452-107329474 CGCTAATAAGTGGTAGAACTAGG - Intronic
1088749737 11:112833588-112833610 CACTACTTAGTGATTGAACTGGG - Intergenic
1089378192 11:118009986-118010008 CAGTAGCCAGTTGTGGAACTTGG + Intergenic
1091216232 11:133904034-133904056 CACTAGTCTGTGGTGGAGGTGGG - Intergenic
1092084644 12:5745739-5745761 AGCGAGTCAGTGGAGGAACTGGG - Intronic
1092249273 12:6883577-6883599 CACAAGTCTTTGGTGGAGCTAGG + Intronic
1092733212 12:11553985-11554007 GGCTAGTTAGTGGTAGAACTGGG - Intergenic
1094217894 12:27963972-27963994 ACCTAGTGAGTGGTAGAACTGGG - Intronic
1094278750 12:28710212-28710234 CAATAGTGAGTGATGGAACATGG - Intergenic
1094339803 12:29398392-29398414 CACTACTTAATGGTGGAACTGGG + Intergenic
1094538983 12:31347298-31347320 AGCTAGTAAGTGGTGGAAATGGG + Intergenic
1094752884 12:33433923-33433945 CACTAGTTAGTGATGGAGATAGG - Intronic
1094818649 12:34208743-34208765 CCCGAGTCCGTGGTGGAGCTGGG - Intergenic
1095148312 12:38758565-38758587 AACTAATCAATGGTGGAACCAGG - Intronic
1096200348 12:49677380-49677402 AGCTAGTAAGTGGTGGAGCTAGG - Intronic
1096230933 12:49896462-49896484 AGCTAGTCAGCGGTAGAACTGGG - Intronic
1096302441 12:50442791-50442813 AACTAGTAAGTGGAAGAACTAGG + Intronic
1096332199 12:50723480-50723502 CATTATTCAGTGAAGGAACTGGG + Intronic
1096373252 12:51085888-51085910 CACTAGTAAGTAGAGGAAGTGGG - Intergenic
1096403595 12:51326654-51326676 AGCTCCTCAGTGGTGGAACTGGG + Intergenic
1097388582 12:58980993-58981015 GACTAGTCACTGGAGGAGCTAGG + Intergenic
1097774262 12:63628023-63628045 CAATTGTCAATGGAGGAACTGGG + Intronic
1098392041 12:69979792-69979814 AACTGGTAAGTGGTGGAGCTGGG + Intergenic
1099062134 12:77924977-77924999 CAGTAGTTAGTGGTGGAACTTGG + Intronic
1101135924 12:101742945-101742967 CACTTATCAGTGAGGGAACTGGG - Intronic
1101170074 12:102082620-102082642 AGCTAGTAAGTGGTGAAACTGGG + Intronic
1101288009 12:103336412-103336434 AGCTAGTCAGTGGTGAAGCTTGG - Intronic
1101331614 12:103761985-103762007 AGCCAGTCAGTGGTGGAAGTGGG - Intronic
1101335071 12:103789704-103789726 CACTAGTTTATGGTGGAAATTGG + Intronic
1101699517 12:107159125-107159147 CATAAGTAAGTGGTAGAACTTGG + Intergenic
1102863320 12:116355083-116355105 CCCTAGTCAGAGGAGGAAGTAGG - Intergenic
1102871819 12:116419750-116419772 CACTAGTGAGTGGTGGATTTGGG + Intergenic
1103173331 12:118841246-118841268 AACTAGTCAGTGTTGGAGGTGGG - Intergenic
1103286428 12:119805254-119805276 AACTAGTAAGTGGTGGAGCTGGG - Intronic
1103743837 12:123108974-123108996 AGCTAGTCAGTGGTGGGATTGGG - Intronic
1104052012 12:125201621-125201643 AGCTAGCCAGTGGTGGAGCTGGG - Intronic
1104159596 12:126165536-126165558 AACTAGTAAGTGGTAGAACCAGG + Intergenic
1104409099 12:128543396-128543418 CGCTAGGAAGTGGTGAAACTGGG + Intronic
1105884840 13:24632905-24632927 TACTAGTCAGTGACAGAACTGGG + Intergenic
1106981491 13:35287796-35287818 ATTCAGTCAGTGGTGGAACTGGG - Intronic
1108248282 13:48539489-48539511 AAGTAGTAAGAGGTGGAACTAGG + Intergenic
1108557256 13:51606067-51606089 AGCTAGTCAGTGGAGGAGCTGGG - Intronic
1108582664 13:51840117-51840139 AGCTAGTAAGTGGTAGAACTGGG + Intergenic
1109822586 13:67677734-67677756 TACTATTCAATGTTGGAACTAGG + Intergenic
1110584663 13:77174814-77174836 AGCTAGTAAGTGATGGAACTAGG + Intronic
1110716053 13:78705436-78705458 CAATAATAAGTGGTAGAACTTGG + Intergenic
1112768439 13:102771891-102771913 CACTGGACAGCGGTGGTACTGGG - Intronic
1115513496 14:34161464-34161486 GATTAGTAAGTGGTAGAACTGGG - Intronic
1116473271 14:45310042-45310064 AACTAGTAAGTGGTAGATCTAGG + Intergenic
1117802663 14:59461336-59461358 AACTATTTAGTGGTAGAACTAGG - Exonic
1119395233 14:74321429-74321451 GGCTAGTAAGTGGGGGAACTTGG + Intronic
1119526489 14:75326765-75326787 AACTAGTCAGTTGTAGAACCAGG - Intergenic
1119785813 14:77313416-77313438 CATTAATTAGTGGTGGAGCTGGG - Intronic
1120213478 14:81657429-81657451 CACTAGTTATTGGTAGTACTGGG + Intergenic
1121454212 14:94027928-94027950 CACCAGGGAGTGGTGGAGCTGGG + Intronic
1121727238 14:96161610-96161632 AACTAGTCAGTGGTGGAGCCAGG + Intergenic
1121831270 14:97054361-97054383 AACTAATCAGTGGTGGGACCAGG + Intergenic
1121885795 14:97541683-97541705 CACTAGGAAGTAGTGGAATTAGG - Intergenic
1122014694 14:98784831-98784853 CACTAGCAAGTGGTAGACCTAGG - Intergenic
1122059015 14:99124359-99124381 AACTATTAAGTGGAGGAACTGGG + Intergenic
1122510099 14:102259663-102259685 ACCTAGTAAGTGGTAGAACTGGG - Intronic
1123584213 15:21742548-21742570 CAGTAGTAACTGGTGGAGCTGGG - Exonic
1123620864 15:22185151-22185173 CAGTAGTAACTGGTGGAGCTGGG - Intergenic
1124051725 15:26202611-26202633 CACTAGACAATGGTAGAACAGGG - Intergenic
1125189621 15:36975605-36975627 AGCTAGTGAGTGGTGGAGCTGGG + Intronic
1126878409 15:53068816-53068838 CACTTGTCAGTGTTGGAAAGAGG + Intergenic
1127816270 15:62611767-62611789 GGCTAGTCAGTGGTAGAGCTGGG - Intronic
1128340926 15:66822041-66822063 AACTAGGCAGTGATGGAAGTTGG - Intergenic
1128555199 15:68627008-68627030 CACTTGGCAGTGGTGGGACTGGG - Intronic
1129261607 15:74371490-74371512 GACCACTCAGTGGTTGAACTAGG - Intergenic
1129655822 15:77525270-77525292 AACTAGTCAGTGTAGGAGCTTGG + Intergenic
1130193374 15:81757095-81757117 CTCTAGTCAGTGACTGAACTGGG - Intergenic
1130774440 15:86964146-86964168 AGCTAGTCAGTGCTGGAATTAGG + Intronic
1131093359 15:89640498-89640520 AGCTAGTAAGTGGTAGAACTGGG + Intronic
1134330024 16:13242176-13242198 AACTAGTAAGTGGTAGAACTGGG + Intergenic
1134602945 16:15547803-15547825 AGCTAGTCAATGGTGGAGCTGGG - Intronic
1135254680 16:20931687-20931709 AGCTAGTCAGTGATAGAACTGGG - Intergenic
1135344943 16:21681024-21681046 CACAACTAAGTGATGGAACTAGG + Intronic
1137565471 16:49530075-49530097 AGCGAGTGAGTGGTGGAACTAGG - Intronic
1137980609 16:53066125-53066147 AACCAGTAAGTGATGGAACTGGG - Intronic
1138557648 16:57781851-57781873 GACCAGTAAGTGGTGGACCTAGG + Intronic
1141648798 16:85381675-85381697 CACTAGTCAGTGTAGTAATTTGG + Intergenic
1141790268 16:86229702-86229724 CACTAGTGAATGCTGGAGCTGGG - Intergenic
1141795425 16:86270226-86270248 CAGTAGTAAGTGGCAGAACTGGG + Intergenic
1141827503 16:86491359-86491381 CATTAGTGAGTGGTGGAGCCAGG - Intergenic
1141892594 16:86936545-86936567 CACTTGTAAGAGGTGGAGCTAGG - Intergenic
1142103564 16:88289643-88289665 CACTTGTGAGTGGTGGAGCTGGG + Intergenic
1143792784 17:9311640-9311662 AGCTAGTAAGTGGTTGAACTGGG - Intronic
1149014514 17:51892198-51892220 TATGAGTAAGTGGTGGAACTGGG + Intronic
1149187174 17:54012691-54012713 ACCTAGTAAGTGGTAGAACTGGG - Intergenic
1151476503 17:74347093-74347115 CACTAGTAAGTGCTGAAAGTAGG + Intronic
1153649627 18:7228585-7228607 AACTAGTCAATGGTAGAACCAGG - Intergenic
1155024852 18:21931859-21931881 CACTAATGAGTGGTAGAACCAGG + Intergenic
1155032330 18:21995595-21995617 AAGTAGTAAGTGGTGAAACTGGG - Intergenic
1155497409 18:26456184-26456206 GGCTAGTCAGTGATGGGACTGGG + Intronic
1155621336 18:27784034-27784056 CACTAGTAAGTGGTGGCATCAGG - Intergenic
1156786877 18:40925608-40925630 CACTAATAAGTGGTAGAATTTGG + Intergenic
1156901940 18:42310291-42310313 CACCATTCCGTGGTTGAACTTGG - Intergenic
1156940444 18:42760629-42760651 AACTAGTAAGTGGCAGAACTGGG - Intronic
1156954198 18:42941920-42941942 GACTAGTTAGTCGTAGAACTGGG + Intronic
1157280953 18:46345962-46345984 CTCTAGTCAGGATTGGAACTCGG + Intronic
1158349480 18:56550434-56550456 CACTAGTAAGTGGCGGAGCTGGG - Intergenic
1160047231 18:75398045-75398067 GACTTTTCAGTGGAGGAACTTGG - Intergenic
1162547614 19:11339878-11339900 GACTAGAAAGTGGTGGAGCTGGG - Intronic
1164649574 19:29882323-29882345 CACTACTCAGTGGTAGAGCTGGG - Intergenic
1165466307 19:35977070-35977092 CACCACTCAGTGTTGGAAATAGG - Intergenic
1165825841 19:38705319-38705341 CACTAGTCTGTTCTGGGACTTGG - Intronic
1166601141 19:44095378-44095400 GACTAGTGAGAGGTGGAGCTGGG + Intronic
925331412 2:3061665-3061687 CCTTTGTCAGTGGTGGAGCTTGG - Intergenic
925445964 2:3927246-3927268 CTCTAGTGAGTGGTGGAGCCCGG + Intergenic
925624865 2:5832475-5832497 CACCAGTCACAGGTGGAATTTGG - Intergenic
925864190 2:8211658-8211680 CACCTGTCAGTGGTGGAGCGTGG - Intergenic
926765815 2:16322027-16322049 CACCTGTAAGTGATGGAACTGGG + Intergenic
927065499 2:19466978-19467000 CATTAGTCAGTGGGGGCACTGGG - Intergenic
927825953 2:26310534-26310556 AGCTACTCAGTGGAGGAACTGGG + Intronic
927974023 2:27324336-27324358 AACTAGTAAGTGGTGGTGCTGGG - Intronic
928081360 2:28315204-28315226 TACTAGACAGTGGTTGAACAAGG - Intronic
930033418 2:47071619-47071641 CACTTGTCAGTGGCAGAGCTGGG + Intronic
930140366 2:47945304-47945326 AACTAGTCAGTGGCAGAGCTGGG + Intergenic
930735971 2:54779145-54779167 AACTTGTCAGTGGTAGAACTAGG + Intronic
931513621 2:63027123-63027145 AGCTAGTCAGTGGTGGAACCAGG - Intronic
932607768 2:73176146-73176168 CACTAGGCAGACGGGGAACTAGG - Intergenic
933782554 2:85812415-85812437 CACTTGGCAGAGCTGGAACTGGG - Intergenic
939139695 2:138339732-138339754 AACTAGTAAGTTGTGAAACTGGG + Intergenic
939861671 2:147428380-147428402 CATGAGTAAGTGGTGGAATTAGG - Intergenic
940901976 2:159134080-159134102 CATGACACAGTGGTGGAACTGGG + Intronic
941875570 2:170429424-170429446 CATAAGTCACTGGTGGGACTGGG - Intronic
942207885 2:173640390-173640412 ATCTAGTAAGTGGTGGAGCTGGG - Intergenic
943084666 2:183297560-183297582 AACTAGGCATTGATGGAACTAGG - Intergenic
943546131 2:189281234-189281256 AACTAGTAAATGGTGGAATTAGG + Intergenic
944919215 2:204393927-204393949 ATCTAGTAAGTGGTGGAACCAGG + Intergenic
944928421 2:204490368-204490390 CACTGGTAAGTGGTAGAACTGGG - Intergenic
944931937 2:204528854-204528876 AACTAGTAAGTGGTAGAGCTGGG + Intergenic
946048291 2:216839397-216839419 CAATAGTCAGTGGCAGAGCTGGG + Intergenic
946483624 2:220079697-220079719 AACTAGTCTGTGGTGGCACCAGG - Intergenic
946550306 2:220793862-220793884 CACTTGTCAAGGGTGGAACCAGG + Intergenic
947773553 2:232689823-232689845 CACTTGTCAGGGGTGGGACAGGG + Intergenic
1169843155 20:9961694-9961716 AGCTACTCAGTGGTGGAACTCGG + Intergenic
1170218194 20:13914546-13914568 AACTAGTAAGTGGTGGGACCAGG - Intronic
1170394652 20:15912984-15913006 AACCAGTCAGTGGTAGAGCTGGG - Intronic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1171049140 20:21839319-21839341 GACTAGTTAGTGGTAGATCTGGG + Intergenic
1171142369 20:22754278-22754300 CACTAGTAAGTGCTGGAGTTTGG + Intergenic
1172437940 20:34943185-34943207 TACTAGTGAGTGGTAGAGCTAGG - Intronic
1174668320 20:52281874-52281896 AGCTAGTAAGTGGTGGAACCAGG + Intergenic
1174675262 20:52347622-52347644 AGCTAGTGAGTGGTGGAGCTGGG + Intergenic
1176347002 21:5757742-5757764 GACTGGTCAGTGGTGGAGCCGGG - Intergenic
1176353816 21:5878326-5878348 GACTGGTCAGTGGTGGAGCCGGG - Intergenic
1176497825 21:7566713-7566735 GACTGGTCAGTGGTGGAGCCGGG + Intergenic
1176541323 21:8155812-8155834 GACTGGTCAGTGGTGGAGCCGGG - Intergenic
1176560274 21:8338857-8338879 GACTGGTCAGTGGTGGAGCCGGG - Intergenic
1178553790 21:33567952-33567974 AACTAATTAGTGGGGGAACTGGG + Intronic
1180033330 21:45227566-45227588 CACTATTCTGTCATGGAACTGGG + Intergenic
1181622538 22:24100908-24100930 TCCAAGTCATTGGTGGAACTAGG + Intronic
1182061562 22:27402099-27402121 AACTAGACAGTGGTGGTATTTGG + Intergenic
1182190057 22:28450390-28450412 AGCTAGTAAGTGGTGGATCTAGG - Intronic
1182228572 22:28819233-28819255 AAATTGTCAGTGGTGGAACTGGG + Intergenic
1182364412 22:29768394-29768416 CACAAGTGAGTGGTGGAACAGGG - Intronic
1183489043 22:38107126-38107148 AACTAGTCACTGGTGAAGCTGGG + Intronic
1203246264 22_KI270733v1_random:72231-72253 GACTGGTCAGTGGTGGAGCCGGG - Intergenic
949714871 3:6918474-6918496 AACTAGTAAGTGATGGAGCTGGG - Intronic
950116448 3:10453458-10453480 GATTAGTGAGTGGTGGATCTGGG + Intronic
950222263 3:11205409-11205431 AGCTAGTGAGTGGTGGAGCTGGG - Intronic
951063386 3:18236465-18236487 GGCTGGTCAGTGGTGGTACTGGG + Intronic
951107947 3:18767867-18767889 TACTAGTAAGTGGTGCAAATAGG + Intergenic
952294167 3:32046857-32046879 AACTACTAAGTGGTGGAACAGGG + Intronic
952959486 3:38580555-38580577 CAATGGTCAGTGTGGGAACTGGG + Intronic
954322256 3:49840172-49840194 CACCAGTCAGTGGTGGTTCTGGG - Intronic
955371256 3:58354106-58354128 GACTAGAAAGTGGTGGATCTGGG - Intronic
955690860 3:61589510-61589532 CACTGGCCAGTTGTGTAACTGGG - Intronic
956021616 3:64939358-64939380 AACTAGTGAGTGGTAGAACCAGG - Intergenic
956350569 3:68330669-68330691 AACTAGTAGGTGGTAGAACTGGG + Intronic
956677426 3:71749282-71749304 AGCTAGTCAGTGGTGGAAACTGG + Intronic
956704798 3:71990182-71990204 AGCTAGAAAGTGGTGGAACTGGG + Intergenic
956713210 3:72056613-72056635 AACTAGTAAGTGGTAGAGCTGGG + Intergenic
958257463 3:91341256-91341278 CAGCAGTCTGAGGTGGAACTGGG - Intergenic
958841756 3:99213600-99213622 CTCTAGTTAGTGGTTGAGCTGGG + Intergenic
958982343 3:100736963-100736985 CATTAGTCAGTGGTGACCCTTGG + Intronic
959156321 3:102670599-102670621 AGCTAGTAAGTGGTAGAACTGGG + Intergenic
960313925 3:116152400-116152422 AGCTAGTCAGTGGTGGAGCTGGG + Intronic
960443785 3:117722221-117722243 ATCTAGTTAGTGGTGGTACTGGG - Intergenic
960883027 3:122365318-122365340 AGCTAGTAAGTGGTAGAACTGGG - Intronic
961515060 3:127427233-127427255 GACTGGTGGGTGGTGGAACTGGG - Intergenic
962840448 3:139227868-139227890 CACTAGTAAGTGGCAGAACCAGG + Intronic
963623727 3:147644966-147644988 AGCTAGTAAGTGGTGGCACTTGG + Intergenic
964073366 3:152663346-152663368 GACTAGTGAGTGATTGAACTGGG + Intergenic
964764290 3:160163747-160163769 AACTGGTAAGTGGTGGAGCTGGG + Intergenic
964954461 3:162335066-162335088 CACTAGACAGTGCTGCAAGTGGG - Intergenic
965801879 3:172502821-172502843 TTCAAGTAAGTGGTGGAACTAGG + Intergenic
966280300 3:178218787-178218809 CCAAAGTCAGTGGTGGAACATGG + Intergenic
967334562 3:188329229-188329251 CACAAGTTAGTGGCGGAGCTGGG + Intronic
968181040 3:196595485-196595507 AACTAGTAAGTGGTAGAACGTGG - Intergenic
969041307 4:4298174-4298196 AGCCAGTGAGTGGTGGAACTAGG + Intronic
969066392 4:4485118-4485140 CACTAGTAAGTGGCAGAGCTGGG - Intronic
969152367 4:5180428-5180450 CACTAGTAAGTGGAGGAGATGGG + Intronic
969660902 4:8526824-8526846 CACTGGGAAATGGTGGAACTGGG + Intergenic
970334984 4:15027934-15027956 TGCTAGTAAGTGGTGGAACTTGG + Intronic
971156323 4:24087191-24087213 CACTAGCCAGCGCTGGAACTTGG + Intergenic
972573064 4:40328244-40328266 GACTAGTAAGTGGTGGTCCTAGG + Intergenic
973288057 4:48441526-48441548 AGCTAGTAAGTGGTGGAACAAGG - Intergenic
973632740 4:52834679-52834701 CTGCAGTCAGTGGTGGAACTGGG + Intergenic
974853973 4:67437334-67437356 CACAGCTCAGTGGTGGAACTAGG + Intergenic
975505973 4:75137977-75137999 CACTAGTGAATGTTAGAACTAGG - Intergenic
976110764 4:81670986-81671008 AGCTAGCCAGTGGTGGATCTAGG + Intronic
976704897 4:88009419-88009441 AGCTAATGAGTGGTGGAACTGGG - Intronic
976770394 4:88646091-88646113 AACTAATGATTGGTGGAACTGGG - Intronic
976782464 4:88776333-88776355 CACACGTAAGTGGTGGAGCTGGG - Intronic
977131527 4:93246233-93246255 CACAATTCATTGCTGGAACTAGG - Intronic
977155696 4:93570196-93570218 CAGTAGCCAGTGGTGGAGCTGGG + Intronic
977183583 4:93908361-93908383 CACTAGTTAGTGGCAGACCTGGG + Intergenic
977755102 4:100660558-100660580 CGCTAATCAGTGATGGAACTTGG - Intronic
978729542 4:112009397-112009419 CTCTATTAAGTGGTGAAACTGGG + Intergenic
979187845 4:117820967-117820989 AACTACTCAGTGGTAAAACTGGG + Intergenic
979476878 4:121168903-121168925 AACTAGCAAGTGGTGGAACTAGG - Intronic
979974045 4:127173821-127173843 AGCTAGTCAGTGGTGAAACAGGG - Intergenic
980885996 4:138763215-138763237 CACTATTAAGTGGTGGAATCAGG - Intergenic
981106825 4:140891322-140891344 CAGTAGTAAGTGGCAGAACTAGG + Intronic
982126769 4:152190539-152190561 AACCAGTCAGTGGTGGGTCTTGG + Intergenic
982691349 4:158550794-158550816 AACCAGTAAGTGGTGGAAATGGG - Intronic
983631591 4:169854795-169854817 AGCTAGTAAGTGGTAGAACTAGG - Intergenic
984173264 4:176386003-176386025 AACTAGTAAGTGGTAGAATTGGG - Intergenic
984287785 4:177755648-177755670 CACAAGTTAGTGGTAGAAGTGGG - Intronic
984445826 4:179834313-179834335 CAGGAGGCAGTGGTGGAAATTGG - Intergenic
984670765 4:182484291-182484313 AGCTAGTCAGTTGTGGAGCTAGG + Intronic
987002001 5:13669119-13669141 CACTAGTCCCTGGTGGAATGTGG + Intergenic
988432177 5:31131871-31131893 CACTCGACTGTGGTGGAAATAGG + Intergenic
988989488 5:36655696-36655718 CACTAGTTAGTGGTGAGGCTAGG - Intronic
989024279 5:37048176-37048198 TACAAGTCAGTGGTGGAGCCAGG + Intronic
989399666 5:40995163-40995185 GGCTAGTAAGTGGTGGAACCAGG + Intergenic
990406119 5:55492838-55492860 AACTAGGAAGTGGTGGAACCAGG + Intronic
990773839 5:59283008-59283030 AACTAGTGATTGGTGGAATTTGG - Intronic
991100406 5:62785545-62785567 GAGTAGTCAGGGGTGGAACTTGG + Intergenic
991974519 5:72173021-72173043 CATTAGTTAGTAGCGGAACTGGG - Intronic
992462144 5:76971201-76971223 CTCAAGTCAGTGGTAGAGCTGGG - Intronic
992578442 5:78145431-78145453 AGCTGGTTAGTGGTGGAACTAGG + Intronic
993387459 5:87276922-87276944 AACTAGGTAGTGGTAGAACTGGG + Intronic
993880435 5:93354219-93354241 CAGTAGTAAGTGATGAAACTTGG - Intergenic
994812842 5:104544461-104544483 CACTAGAAAGTGGTGGACATGGG - Intergenic
994848946 5:105027898-105027920 CACTTGTCAAGGGAGGAACTTGG + Intergenic
995337580 5:111018356-111018378 CACAAGTAAGTGGTGGAATATGG + Intergenic
995575267 5:113524130-113524152 AACTAGTAAGTGGTAGAAGTGGG + Intronic
997860155 5:137408815-137408837 AGCTAGTAAGTGGTGGAGCTGGG - Intronic
998868431 5:146529213-146529235 CTCTAGTCAGTGGCAGAGCTGGG - Intergenic
998906258 5:146908698-146908720 CACTAGTCAGTGTCAGACCTAGG + Intronic
999018059 5:148130818-148130840 CTCTAGTTAGTGGTAGAGCTAGG + Intronic
999683100 5:154078082-154078104 AACTAGTGAGTGGTGCAGCTGGG - Intronic
1000396023 5:160775612-160775634 AGCTAGTAAGTGGTGGAGCTTGG - Intronic
1001165858 5:169366201-169366223 CCATAGTCAGTGGTGGAAATGGG - Intergenic
1001258752 5:170206930-170206952 GACTAGTCAGTTGTGGCTCTGGG - Intergenic
1001459762 5:171901061-171901083 AACTAGTAAGTGGTGAACCTGGG - Intronic
1001487348 5:172129030-172129052 CACTAGTGAGCGGTGGACCTGGG - Intronic
1003066018 6:2903821-2903843 TACTAGTTAGTGGTGGGACCTGG - Intergenic
1003086164 6:3063407-3063429 TACTAGTTAGTGGTGGGACCTGG + Intergenic
1003650065 6:7951289-7951311 CACCCTTCAGTTGTGGAACTAGG - Intronic
1003663588 6:8088011-8088033 CCCAAGTAAGTGGTGGAACGAGG - Intronic
1004211403 6:13649722-13649744 TAGTAGCCAGTGGTGGAAGTGGG - Intronic
1004504494 6:16237261-16237283 AGCTAGACAGTGGTGGAACCAGG + Intergenic
1004559598 6:16735134-16735156 AGCTAGTAAGTGGTGGGACTGGG - Intronic
1007175303 6:39892400-39892422 CACTGGTGAGTGGTGGAACCAGG + Intronic
1007405555 6:41634204-41634226 CACTAGTAATGGGTGGAGCTGGG - Intergenic
1007895166 6:45348248-45348270 AGCTATTCAGTGGTAGAACTGGG - Intronic
1008108106 6:47462004-47462026 CAAGTGTCAATGGTGGAACTGGG + Intergenic
1008578836 6:52886938-52886960 CCATAGTAAGTGGTGGATCTGGG + Intronic
1008717498 6:54306793-54306815 TGCTAGTCAGTGGCAGAACTAGG + Intergenic
1008997844 6:57679767-57679789 CAGCAGTCTGAGGTGGAACTGGG + Intergenic
1010438720 6:75866782-75866804 CACTAGTCAGTGTGGACACTGGG - Intronic
1011067259 6:83340612-83340634 CACTAGTAAGTGGTGAAACTGGG + Intronic
1011696950 6:89921482-89921504 CACTAGGCTGTGCTGGGACTGGG - Intergenic
1013016999 6:106168955-106168977 CACTTGTCACTGGTGGAACCCGG - Intergenic
1013692081 6:112657797-112657819 GGCTTGTAAGTGGTGGAACTGGG - Intergenic
1014816604 6:125942717-125942739 CACTACTAAGTGGTAGAAATGGG + Intergenic
1015474002 6:133638620-133638642 AACTTGTAAATGGTGGAACTGGG - Intergenic
1017995994 6:159532169-159532191 CACATGTCAGTGATGGAACTCGG + Intergenic
1018360185 6:163059652-163059674 AGCTAGTCAGTGCTGGAATTAGG - Intronic
1019869475 7:3745938-3745960 AGCTAGTCTGTGGTGGAGCTGGG - Intronic
1020417475 7:7962458-7962480 CTTTAGTCAGTTGTTGAACTCGG + Intronic
1020857917 7:13452013-13452035 CACGAGTCAGGGGAGGGACTTGG + Intergenic
1021414383 7:20365414-20365436 CATTAGAAACTGGTGGAACTAGG - Intronic
1021892900 7:25204336-25204358 CACACGTCAGAGCTGGAACTAGG + Intergenic
1022162879 7:27729246-27729268 AACTAGTAAGTGGTGGAGCCAGG + Intergenic
1022208719 7:28187539-28187561 AGCTAGTAAGTGCTGGAACTAGG + Intergenic
1022426223 7:30271340-30271362 AGCTAGTAAGTGGTGGAATTGGG + Intergenic
1022662208 7:32377742-32377764 CACTAGTAAATGGTGGAATTGGG + Intergenic
1022703803 7:32784904-32784926 AACTGGTCAGTGGTGGAAGAAGG - Intergenic
1022908044 7:34875028-34875050 AACTGGTCAGTGGTGGAAGCAGG - Intronic
1022925468 7:35052099-35052121 CACTAGTTAGGGGTGGAGCTGGG + Intergenic
1022990489 7:35702544-35702566 CACTGGGCACTGCTGGAACTGGG - Intergenic
1024326978 7:48116459-48116481 GACTAGTCAATGGTGGATATGGG + Intergenic
1024486075 7:49921476-49921498 AACCAGTAAGTGGTAGAACTGGG - Exonic
1025142745 7:56479276-56479298 CCCTGGTCAGTGGTGGTCCTGGG + Intergenic
1025635112 7:63314863-63314885 CACTGGTCAGTGGGGTAACGAGG + Intergenic
1025647583 7:63433307-63433329 CACTGGTCAGTGGGGTAACGAGG - Intergenic
1025708799 7:63889876-63889898 CCCTGGTCAGTGGTGGTCCTGGG + Intergenic
1026472630 7:70707379-70707401 ACCTAGTAAGTGGTGGAGCTCGG + Intronic
1026962254 7:74416487-74416509 CCCAAGTCAGAGTTGGAACTTGG - Intergenic
1028460583 7:91087460-91087482 CACAGCTCAGTAGTGGAACTAGG - Intronic
1028658709 7:93241299-93241321 CACTGGTCACTGATGGAGCTAGG - Intronic
1029236494 7:99124018-99124040 TACTGGTATGTGGTGGAACTGGG + Intronic
1029823480 7:103166797-103166819 CACTAGTTAGCGGTGGAGCTGGG + Intergenic
1031692330 7:124804262-124804284 AACTAGTAAGTGGTAGTACTAGG - Intergenic
1031903142 7:127431560-127431582 AATCAGTAAGTGGTGGAACTTGG - Intronic
1037944085 8:22975567-22975589 CACTAGAAAGTGCTAGAACTAGG + Intronic
1038005119 8:23423541-23423563 AACTAGCCAGTGGTGGGGCTGGG - Intronic
1038296565 8:26296949-26296971 CACTAGTTTGTGCTGGAGCTAGG - Intronic
1038331233 8:26611115-26611137 AACTAGTCAGTGGTAGAGCCAGG + Intronic
1038949191 8:32395248-32395270 AACTAGTAAGTGGTAGAACCAGG + Intronic
1041408883 8:57531873-57531895 AGCTAGTGAGTGGTGGAGCTAGG - Intergenic
1041880643 8:62745907-62745929 AGCTAGTTAGTGGTGGAGCTGGG - Intronic
1042346009 8:67728798-67728820 CACTAGTAAGTGGAAGAACTAGG + Intronic
1042621820 8:70715167-70715189 GATTAGTAAGTGGTGGAGCTAGG - Intronic
1042848054 8:73187861-73187883 CACTCCTCAGTGGTGCAGCTTGG - Intergenic
1042857959 8:73286158-73286180 CACTGGTCAGTGGTGACACAAGG + Intergenic
1043891138 8:85654129-85654151 ACCTAGTAAGTGGTGGAATTTGG + Intergenic
1043892214 8:85660966-85660988 ACCTAGTAAGTGGTGGAATTTGG + Intergenic
1043893349 8:85716374-85716396 ACCTAGTAAGTGGTGGAATTTGG - Intergenic
1043896032 8:85737823-85737845 ACCTAGTAAGTGGTGGAATTTGG - Intergenic
1043896647 8:85743985-85744007 ACCTAGTAAGTGGTGGAATTTGG + Intergenic
1043898970 8:85762352-85762374 ACCTAGTAAGTGGTGGAATTTGG + Intergenic
1043900581 8:85774546-85774568 ACCTAGTAAGTGGTGGAATTTGG + Intergenic
1043902545 8:85789821-85789843 ACCTAGTAAGTGGTGGAATTTGG + Intergenic
1043904155 8:85802014-85802036 ACCTAGTAAGTGGTGGAATTTGG + Intergenic
1043905767 8:85814208-85814230 ACCTAGTAAGTGGTGGAATTTGG + Intergenic
1043907375 8:85826395-85826417 ACCTAGTAAGTGGTGGAATTTGG + Intergenic
1044612013 8:94100921-94100943 AGCTAGTAAGTGGTGGAGCTGGG + Intergenic
1047683173 8:127276134-127276156 TACTGATAAGTGGTGGAACTGGG - Intergenic
1048284346 8:133130166-133130188 CACTAGTCAGTGACTGAGCTGGG + Intronic
1049204700 8:141358350-141358372 CACTAGTCAGTGGCACAGCTGGG - Intronic
1050227141 9:3472297-3472319 AAGTAGTAAGTGGTGGAGCTAGG - Intronic
1050227526 9:3476884-3476906 AAGTAGTAAGTGGTGGAGCTAGG - Intronic
1050288947 9:4133537-4133559 AGCTAGTCAGTGGTGGAGCCAGG - Intronic
1050560596 9:6831121-6831143 CACTAGTCAGTGGGGGAAGCGGG + Intronic
1050931309 9:11330677-11330699 CACCAGGCAGGGGTGGAGCTGGG - Intergenic
1052002662 9:23305726-23305748 AGATAGTCAGTGGTGGAACCAGG - Intergenic
1052347366 9:27423982-27424004 AGCTAGTAAGTGGTGGAATTAGG + Intronic
1052515670 9:29476370-29476392 AAATAGTCAGTGGTGGAGCTAGG + Intergenic
1052522337 9:29563728-29563750 CACATGTCAGGGGAGGAACTTGG + Intergenic
1052743582 9:32417102-32417124 CACTAGTCAGTGGTGGAACTGGG - Intronic
1052865969 9:33464861-33464883 CACTGGTAAGTGGTAGAACAGGG - Exonic
1053180430 9:35963309-35963331 CACTAGTGAGTGGCAGAGCTGGG + Intergenic
1053409918 9:37909347-37909369 CACTAGGAAGTGGTGGATCAAGG - Intronic
1055404464 9:75959996-75960018 CACTAGTTTGTGGAGGACCTAGG + Intronic
1056619459 9:88199348-88199370 CACCAGTCACGGGTGGAAATAGG + Intergenic
1058017753 9:100055064-100055086 GGCTAGTAAGTGGTGGAACTGGG - Intronic
1058195870 9:101974798-101974820 AGCTAGTAAGTGGTGGAGCTGGG - Intergenic
1058989740 9:110243323-110243345 AACTAGTCATTGGAGGAGCTGGG - Intergenic
1059035185 9:110747095-110747117 CACAAGTCTGTGGTTCAACTGGG + Intronic
1059219753 9:112603517-112603539 CTCTAATCCATGGTGGAACTGGG - Intronic
1059395915 9:114033988-114034010 AGCTAGTAAGTGGTGGAGCTGGG - Intronic
1059628547 9:116094036-116094058 AACTAGTGAATGGTGGAAGTGGG + Intergenic
1059721807 9:116967300-116967322 AGCTAGTCAGTGGTGGAGCTGGG + Intronic
1060342058 9:122786228-122786250 CACCAGAAAGTTGTGGAACTAGG + Intergenic
1060535618 9:124384876-124384898 TACCTGTCAGTGGTGGAAGTAGG - Intronic
1060659055 9:125392426-125392448 CACTAGTAAGTGGTAGAGCTGGG - Intergenic
1060869405 9:127027824-127027846 GGCTAGTAAGTGCTGGAACTGGG - Intronic
1062602353 9:137323623-137323645 CCCTAGACAGTGGTGGGTCTGGG - Intronic
1203462597 Un_GL000220v1:55303-55325 GACTGGTCAGTGGTGGAGCCGGG - Intergenic
1187290858 X:17951966-17951988 AGCCAGTCAGTTGTGGAACTAGG + Intergenic
1187699558 X:21952066-21952088 CACTAGTAAGTAGTGGAACCAGG - Intronic
1189141932 X:38616305-38616327 AGCTAGTAAGTGGTGGAGCTGGG + Intronic
1189368742 X:40410991-40411013 CAATGGTAAGTGGTGGAGCTAGG + Intergenic
1189716975 X:43877167-43877189 AGCTAGTTAGTGGTGGAACCAGG + Intronic
1190389917 X:49921885-49921907 GACTAGTACGTGGTAGAACTGGG - Intergenic
1190435443 X:50419969-50419991 CACTATTCAGTAGTGAAACCAGG - Intronic
1193094913 X:77537157-77537179 GGCTAATAAGTGGTGGAACTAGG - Intronic
1193726616 X:85047850-85047872 AACTAGTCAGTCGTGGAATCAGG - Intronic
1194270961 X:91815115-91815137 AGCTAGTGAGTGGTGGATCTTGG + Intronic
1194883951 X:99289420-99289442 TCCTGGTCAGTGGTGGAACCAGG + Intergenic
1194947307 X:100084347-100084369 CATTATTCAGTGGTGGAACTGGG - Intergenic
1195003845 X:100667922-100667944 AGCTAGTAAGTGGTGGAGCTGGG + Intronic
1195131739 X:101860275-101860297 AACAAGTCAGTGGTGGAAAATGG - Intergenic
1195316989 X:103688679-103688701 GACTAGTAAGTGGTGGAATGAGG - Intergenic
1195495207 X:105523285-105523307 AACTAGTAAATGGTGGAACCAGG - Intronic
1195853059 X:109304028-109304050 AACTAGTAAGTGGTGGAATCAGG - Intergenic
1196654187 X:118199682-118199704 GACTAGTAAGTAGTGGAGCTAGG - Intergenic
1197053173 X:122085325-122085347 CACAAGTTAGTGGTGGAAATAGG - Intergenic
1197627564 X:128819789-128819811 ACCCAGTAAGTGGTGGAACTGGG + Intergenic
1197720465 X:129741355-129741377 CAGGAGTCAGTGGTAGAACAGGG - Intronic
1197905693 X:131423030-131423052 AACTAGTAAGTGGTGGAGCTAGG - Intergenic
1198241583 X:134792649-134792671 AATTAGTAAGTGGTAGAACTGGG - Intronic
1198250758 X:134877333-134877355 AGCTAGTAAGTGGTAGAACTGGG + Intergenic
1198768489 X:140103106-140103128 GGCTAGTCAGTGGTAGAACTGGG + Intergenic
1198829461 X:140733415-140733437 AACTAGTAAGTGATGGAGCTGGG - Intergenic
1199974284 X:152883710-152883732 GGCTAGTGAGTGGTGGAGCTGGG - Intergenic
1200588203 Y:5036553-5036575 AGCTAGTGAGTGGTGGATCTTGG + Intronic
1202626534 Y:56865207-56865229 CACTAGTTAGTAGTGCATCTAGG + Intergenic