ID: 1052743954

View in Genome Browser
Species Human (GRCh38)
Location 9:32421482-32421504
Sequence AATCCAACCCTGCAACTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052743953_1052743954 3 Left 1052743953 9:32421456-32421478 CCAAGGCTAATAAACAGCAGAGT 0: 1
1: 0
2: 0
3: 20
4: 214
Right 1052743954 9:32421482-32421504 AATCCAACCCTGCAACTGCCTGG No data
1052743952_1052743954 4 Left 1052743952 9:32421455-32421477 CCCAAGGCTAATAAACAGCAGAG 0: 1
1: 0
2: 0
3: 29
4: 242
Right 1052743954 9:32421482-32421504 AATCCAACCCTGCAACTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052743954 Original CRISPR AATCCAACCCTGCAACTGCC TGG Intronic
No off target data available for this crispr