ID: 1052744433

View in Genome Browser
Species Human (GRCh38)
Location 9:32426339-32426361
Sequence AACTCAATCCTGCTGCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 163}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052744433_1052744438 -3 Left 1052744433 9:32426339-32426361 CCCCTGAGCAGCAGGATTGAGTT 0: 1
1: 0
2: 0
3: 24
4: 163
Right 1052744438 9:32426359-32426381 GTTCTGACGTGAATGCTGGGAGG No data
1052744433_1052744443 26 Left 1052744433 9:32426339-32426361 CCCCTGAGCAGCAGGATTGAGTT 0: 1
1: 0
2: 0
3: 24
4: 163
Right 1052744443 9:32426388-32426410 TCAGTGAGGGCACAGGGCACTGG No data
1052744433_1052744442 20 Left 1052744433 9:32426339-32426361 CCCCTGAGCAGCAGGATTGAGTT 0: 1
1: 0
2: 0
3: 24
4: 163
Right 1052744442 9:32426382-32426404 TGTTTCTCAGTGAGGGCACAGGG No data
1052744433_1052744439 12 Left 1052744433 9:32426339-32426361 CCCCTGAGCAGCAGGATTGAGTT 0: 1
1: 0
2: 0
3: 24
4: 163
Right 1052744439 9:32426374-32426396 CTGGGAGGTGTTTCTCAGTGAGG No data
1052744433_1052744437 -6 Left 1052744433 9:32426339-32426361 CCCCTGAGCAGCAGGATTGAGTT 0: 1
1: 0
2: 0
3: 24
4: 163
Right 1052744437 9:32426356-32426378 TGAGTTCTGACGTGAATGCTGGG No data
1052744433_1052744441 19 Left 1052744433 9:32426339-32426361 CCCCTGAGCAGCAGGATTGAGTT 0: 1
1: 0
2: 0
3: 24
4: 163
Right 1052744441 9:32426381-32426403 GTGTTTCTCAGTGAGGGCACAGG No data
1052744433_1052744440 13 Left 1052744433 9:32426339-32426361 CCCCTGAGCAGCAGGATTGAGTT 0: 1
1: 0
2: 0
3: 24
4: 163
Right 1052744440 9:32426375-32426397 TGGGAGGTGTTTCTCAGTGAGGG No data
1052744433_1052744436 -7 Left 1052744433 9:32426339-32426361 CCCCTGAGCAGCAGGATTGAGTT 0: 1
1: 0
2: 0
3: 24
4: 163
Right 1052744436 9:32426355-32426377 TTGAGTTCTGACGTGAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052744433 Original CRISPR AACTCAATCCTGCTGCTCAG GGG (reversed) Intronic
901150726 1:7099451-7099473 AGCTCAATCCTGTTTCCCAGGGG + Intronic
904017242 1:27431566-27431588 TACTCATTCCAGCTTCTCAGAGG + Intronic
904876207 1:33656466-33656488 CACTAAATCCTGCTCCTCAGTGG - Intronic
906054348 1:42903191-42903213 AACTCGAGCCTGCTGCTCTCCGG + Intergenic
907889270 1:58622168-58622190 AAGACAATCCTGCCCCTCAGGGG + Intergenic
916918507 1:169437628-169437650 AACTTCTTCCTGCTGATCAGGGG + Intronic
919114239 1:193260606-193260628 AACTCCATCCTGTTACTGAGGGG - Intergenic
920336938 1:205251211-205251233 AACTCCCTACTGCAGCTCAGGGG - Intronic
920700234 1:208212486-208212508 AACTCATTCCTTCTGCTCTGTGG - Intronic
922391304 1:225146264-225146286 ATCTGATTCCTGCTGCTCAGTGG + Intronic
923718769 1:236449523-236449545 AACTCCAGCCTTCTGCTCAGAGG - Intronic
1063731884 10:8707159-8707181 AATTGAATCCTGCAGCTCTGAGG + Intergenic
1063940515 10:11123690-11123712 ACCCCCATCCTGCTGCGCAGTGG + Intronic
1064145135 10:12820925-12820947 AGCTCATTCCTCCAGCTCAGTGG + Intronic
1070985530 10:80686687-80686709 AAATCACTCCTGCTGCTCCCAGG - Intergenic
1071748580 10:88449625-88449647 AAATCAATCCAGGTGCTCTGAGG + Intronic
1072869977 10:99107929-99107951 AGTTCAATCTTGCTTCTCAGTGG - Intronic
1073032765 10:100540752-100540774 ACCTCTAACCTGCTGCTCATTGG + Exonic
1073219498 10:101858318-101858340 AGCTCCATCCTGCTGCTAACTGG - Intronic
1075087351 10:119422525-119422547 AACCCAAGCCTGCAGCTCCGGGG + Intronic
1075497442 10:122936978-122937000 AACTCAATCCTGTTGGTTGGTGG + Intronic
1077331933 11:1987661-1987683 AAGGCCTTCCTGCTGCTCAGAGG + Intergenic
1078018311 11:7634203-7634225 CACTCAATTCTGCTGCACTGAGG - Intronic
1080590823 11:33721996-33722018 AGCTCAGTCCTTCTGCTCTGAGG - Intronic
1085712207 11:78840450-78840472 AACTAAAACCAGATGCTCAGAGG + Intronic
1086120898 11:83303771-83303793 AAGTCAAGGCTTCTGCTCAGGGG + Intergenic
1087160444 11:94943198-94943220 AACTCAGTCTTGATGCTAAGGGG + Intergenic
1088364083 11:109020591-109020613 ACCTCAAGGCTGCTGGTCAGTGG - Intergenic
1088890602 11:114041221-114041243 AACTCATTCCTGGTGGCCAGAGG - Intergenic
1089956280 11:122574363-122574385 ATCTCCATCCTCCTGCTCTGGGG + Intergenic
1202814914 11_KI270721v1_random:42837-42859 AAGGCCTTCCTGCTGCTCAGAGG + Intergenic
1093983361 12:25499769-25499791 AATTCAAGCCTGCTGCACACAGG - Intronic
1095498587 12:42811855-42811877 AACTAAAACTTGCTGCTCAGGGG + Intergenic
1097842847 12:64338812-64338834 AACTCGAGCCTGCTGCTCACCGG - Intronic
1098217791 12:68238429-68238451 GACTCCATCCTGCTGCTGGGTGG + Intergenic
1099153078 12:79139824-79139846 GACTCACTCATTCTGCTCAGTGG - Intronic
1102270230 12:111527675-111527697 AGCTGAGTCCTGCTGCTCTGGGG - Intronic
1103590884 12:121991453-121991475 AAGTCAATCCTGTTGGTCTGGGG - Intronic
1103668429 12:122591407-122591429 AACTCAGTACTGATGCCCAGTGG + Exonic
1103738645 12:123077103-123077125 ATTTCAAGCCTGCTGCCCAGTGG - Intronic
1104256983 12:127147437-127147459 AGGTCAATCCTACTGCTCTGTGG + Intergenic
1104738110 12:131152442-131152464 AACTCAGTCCTGCTGATTGGTGG + Intergenic
1106927756 13:34631212-34631234 CACTCCATCCTGCTGCTCTGTGG - Intergenic
1107947261 13:45430424-45430446 TACTCAATCCCGATGCCCAGAGG - Intergenic
1108360762 13:49666237-49666259 AACTGAAGCCTGCTACTGAGGGG + Intronic
1109528909 13:63614601-63614623 AACTCAATCACGCTGCTCTATGG - Intergenic
1110986160 13:81972055-81972077 AACTCAATGCTATTGCTCATTGG + Intergenic
1111582452 13:90240719-90240741 AACTCAGCTCTGCTGCACAGTGG + Intergenic
1112607207 13:100918570-100918592 AACTCACTTCTGCTGCTGACAGG + Intergenic
1113438436 13:110310380-110310402 AACCCAATACTGTAGCTCAGTGG - Intronic
1121414269 14:93768222-93768244 AACTCAATCCTGCCCTCCAGGGG - Intronic
1125176837 15:36832547-36832569 ATCTCAATACTGCAGCTGAGAGG + Intergenic
1126656909 15:50988266-50988288 AACTCAGTTCTGCTGATCATTGG + Intronic
1128159626 15:65415168-65415190 AACCCAAACCTACTGCTTAGTGG - Intronic
1129048111 15:72755149-72755171 TAGTCAATGCTGCTGCCCAGAGG + Intronic
1131304018 15:91225150-91225172 AACTCAATTCTGCTGCACAATGG - Intronic
1132676982 16:1124957-1124979 ATGTCAATCCTGCTGGCCAGGGG - Intergenic
1133154276 16:3861545-3861567 AACTCATCCCTGCTGATCTGTGG + Intronic
1134620825 16:15687794-15687816 AAATAAATTCTGCTGCCCAGAGG - Intronic
1139175715 16:64684684-64684706 AAGTCATTCCTGCTACTCTGGGG + Intergenic
1139440971 16:66966634-66966656 CACTCAGGCCTGCAGCTCAGTGG + Intronic
1140615162 16:76654201-76654223 AAATCAATATTGCTGCTCAGTGG - Intergenic
1140677596 16:77348548-77348570 AAGTCACTCCTGCTGCTTTGAGG + Intronic
1141411686 16:83838501-83838523 AACTCGATCCTCCTACTCTGCGG - Intergenic
1141424687 16:83937132-83937154 AAATCCCTCCTGCTCCTCAGTGG + Intronic
1142605900 17:1080875-1080897 AAATCACTCCTGCTGCAGAGAGG + Intronic
1143753996 17:9053169-9053191 AACTCAATCCTGCTGTTGTATGG - Intronic
1143917266 17:10303087-10303109 AACTCAGGCCTGAGGCTCAGGGG + Intronic
1144080216 17:11757586-11757608 TTCTCAATCCAGCTGCTCACTGG - Exonic
1144812283 17:18008101-18008123 CCCTCACTCCTGATGCTCAGCGG + Intronic
1146005861 17:29160246-29160268 AATTCTATTCTGCTTCTCAGAGG + Intronic
1146916625 17:36682238-36682260 AAATCAATCCTGGTGATCAACGG - Intergenic
1150939208 17:69671855-69671877 ATCTCAATCATTGTGCTCAGTGG - Intergenic
1151119115 17:71772591-71772613 AACTAAATCCTGATGGGCAGAGG - Intergenic
1151350637 17:73529966-73529988 GACCCATTCCTGCTGCCCAGTGG + Intronic
1153340285 18:3966410-3966432 AAATCACTCCAGCTGCTCAGTGG + Intronic
1157990912 18:52495161-52495183 AACTCCATTCTGCTTCTCAGAGG + Intronic
1161046957 19:2140120-2140142 AACCCACTCCTCCTGCTCAAAGG + Intronic
1161330540 19:3684799-3684821 AACCAGATCCTGGTGCTCAGAGG - Intronic
1161464545 19:4421362-4421384 AACACAATCCTGCTGGGCTGAGG - Intronic
1166969138 19:46551218-46551240 AACTCTATTCTGCTTTTCAGAGG + Intronic
924987706 2:287468-287490 AAAGGAATCCTGCTGTTCAGTGG + Intronic
927189324 2:20506315-20506337 AGCTCATTCCAGCTGCTCTGAGG - Intergenic
927198992 2:20566967-20566989 AACTCAATCCTTGTTCTCAGGGG - Intronic
927261166 2:21092544-21092566 AGTTCAATCCTGCGGCACAGTGG - Intergenic
929897713 2:45976249-45976271 CGCTCACTCCAGCTGCTCAGTGG + Intronic
936061501 2:109298086-109298108 CACTCAAACCTGCTTCTCAGGGG + Intronic
936168416 2:110145242-110145264 TCCTCAATTCTGCTCCTCAGAGG + Intronic
938559859 2:132462365-132462387 AACTGAAACCTACTTCTCAGGGG + Intronic
938700382 2:133872775-133872797 AACTTCCTCCTGCTGATCAGGGG + Intergenic
942573356 2:177336582-177336604 AACTCAATCCTAATGCTCACAGG - Intronic
945190786 2:207185366-207185388 AACTCCATCCTGGAGCTCATGGG - Intergenic
946502231 2:220261742-220261764 AACTCAATCCTGTTCCTGATTGG + Intergenic
946563947 2:220942433-220942455 AAATCAAACCTGCTACTAAGTGG - Intergenic
947340165 2:229129880-229129902 AAATCTGTCCTGCTGCCCAGTGG + Intronic
948111986 2:235463731-235463753 AACTGGATCCTGCTCCCCAGCGG + Intergenic
1172120327 20:32594641-32594663 AACGCAGTCTTGCTGTTCAGGGG - Intronic
1172261320 20:33568435-33568457 AACTCAAACCTGTTGCTGTGTGG + Intronic
1175674977 20:60938482-60938504 GACTCAATCCTCCTTCCCAGTGG - Intergenic
1178491632 21:33056258-33056280 AACTCCAGCCTGCTGCACAAAGG - Intergenic
1183300212 22:37055289-37055311 AAATCAACCCTGGTGATCAGTGG + Intronic
1184155935 22:42667184-42667206 AACTGAAACCAGCTACTCAGGGG - Intergenic
1184981667 22:48099961-48099983 AGATCCATCCAGCTGCTCAGAGG + Intergenic
949198518 3:1342590-1342612 AACTCAATACAGCTGCCCAAAGG + Intronic
949279206 3:2326644-2326666 AACTCATTCCTTCTGGTCACTGG + Intronic
952025275 3:29073071-29073093 AACTTAATCCTAATTCTCAGAGG + Intergenic
952328764 3:32344517-32344539 ACAGCAATTCTGCTGCTCAGAGG - Intronic
954445877 3:50546640-50546662 AACTGAGTCCTGGTGCCCAGTGG - Intergenic
955398432 3:58573864-58573886 ATCTCAACTCTGCTGTTCAGTGG - Intronic
960116937 3:113904687-113904709 TACTCAAGCATGCTGCTCAGGGG - Intronic
961561551 3:127733839-127733861 CACTCCATCCCTCTGCTCAGAGG - Intronic
965321003 3:167251082-167251104 CACCCCATCCTGCTGGTCAGTGG - Intronic
966708120 3:182939708-182939730 AATTTACTCCTGCTGCTCTGCGG - Exonic
967842214 3:194015382-194015404 AACTCATTTCTGCTGGACAGTGG - Intergenic
968339497 3:197943076-197943098 AACTCAGTGCTGCTTCACAGAGG + Intronic
970449795 4:16155641-16155663 AACTGTTTCCTGCTGCTCGGTGG + Intergenic
971928363 4:33044726-33044748 AACTAAATGCTGCTGCCCTGGGG - Intergenic
973650744 4:52994978-52995000 AACTGATCCCTGCTGCTCTGTGG - Intronic
973890951 4:55366789-55366811 AACTGCTTCCTGCTGCGCAGAGG + Intronic
974155370 4:58064906-58064928 AACTTTATCCTCGTGCTCAGTGG + Intergenic
977527594 4:98163868-98163890 AACTTCTTCCTGCTGATCAGGGG - Intergenic
982563697 4:156962933-156962955 ATCTAAATCCTGCTGCTCCCAGG + Intronic
985714401 5:1447132-1447154 TCCTCAACCCTGCTGCTCTGGGG - Intergenic
986151374 5:5133188-5133210 AACTCCATCCTGCTGCTGGGGGG - Intergenic
986173671 5:5333934-5333956 AACTCTGTCCTGCTGCTGAGGGG - Intergenic
991050569 5:62268464-62268486 AACTAAATCTTGCTCCTGAGTGG - Intergenic
992566101 5:77996723-77996745 AACTCAAGCATGCTGATAAGGGG - Intergenic
996134481 5:119822705-119822727 AACTCAATCTTCCTGGTAAGAGG - Intergenic
998887800 5:146712648-146712670 AAATCAACCCTGGTGATCAGTGG - Intronic
1000155810 5:158550284-158550306 ATCTCAGTCCTGGTGATCAGAGG - Intergenic
1000518174 5:162266065-162266087 CACTCAATCCTCCTGCTCTGTGG + Intergenic
1002107946 5:176889380-176889402 CCCTGAATCCTGGTGCTCAGAGG - Exonic
1003141426 6:3474640-3474662 GAATCCATACTGCTGCTCAGAGG - Intergenic
1003673703 6:8182996-8183018 AACTCGAGCCTGCTGCTCATAGG + Intergenic
1005321989 6:24664616-24664638 AACTCAACCCTGCTGAGCAAGGG - Intronic
1006898162 6:37483853-37483875 AAATCAGTCCTGCTGCTCTATGG + Intronic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1009355522 6:62739968-62739990 AACTCATTCCTGGTGCCCAGTGG + Intergenic
1012387346 6:98697586-98697608 AGCTTAATCCAGCTGCCCAGTGG + Intergenic
1012664234 6:101946720-101946742 AACTCAATTCTACTGCTCAAAGG + Intronic
1014170775 6:118276952-118276974 ATGTCAGTGCTGCTGCTCAGAGG - Intronic
1015554864 6:134450716-134450738 AACTCAATTTTACTGCTCCGTGG - Intergenic
1018394806 6:163370053-163370075 CACCCCATCCTGCTGCTCTGTGG + Intergenic
1019280705 7:198541-198563 AACCCACTCCTGTTCCTCAGAGG - Intronic
1019288436 7:235343-235365 AGCTCAACCCTGCAGCCCAGTGG + Intronic
1023122877 7:36926753-36926775 AACTCATTGCTGAAGCTCAGAGG + Intronic
1026044371 7:66895828-66895850 AACTCAATCATGCAGCTATGTGG - Intergenic
1026511910 7:71034412-71034434 AACTGAAGCCTGCTACTCAAGGG - Intergenic
1027466189 7:78517330-78517352 ATCGCAATCCTGCAGCTTAGAGG - Intronic
1027778071 7:82491686-82491708 AACTTGCTCCTTCTGCTCAGAGG + Intergenic
1029588963 7:101494593-101494615 AACTCAATCCTGCCCCTCAAGGG - Intronic
1029690983 7:102181285-102181307 AACTGAATCCTGGTACTCATTGG - Intronic
1031703248 7:124951347-124951369 ATCTAAATCCTGTTTCTCAGAGG + Intergenic
1032417749 7:131750289-131750311 AACACATTCTGGCTGCTCAGAGG - Intergenic
1032453155 7:132052000-132052022 AAGTCACTCCTGCTGCTCCTGGG - Intergenic
1032502085 7:132407262-132407284 ATCTCATCCCTGCTGTTCAGAGG - Intronic
1033125879 7:138706709-138706731 AACTCAACCCTGTTGTTGAGGGG + Exonic
1033402630 7:141041237-141041259 CAATCAATGCTGCTGCTGAGGGG - Intergenic
1034530858 7:151695711-151695733 AACGCCACCCTGCTGCCCAGGGG - Intronic
1034844164 7:154429241-154429263 AAATCCATCCAGCTGGTCAGTGG + Intronic
1034980378 7:155472002-155472024 AAGTTAATGCTGCAGCTCAGTGG + Intergenic
1036756201 8:11472866-11472888 GACTCTATCCTGCTGGGCAGAGG + Intronic
1039228640 8:35418955-35418977 CACTCAATTCTGCTGCTCACTGG + Intronic
1042173476 8:66015708-66015730 AACACCTTCCTGCAGCTCAGTGG - Intergenic
1042623183 8:70728315-70728337 AACTTCTTCCTGCTGATCAGGGG + Intronic
1047157910 8:122342226-122342248 AACTCAATGCTGCTGCAGTGAGG + Intergenic
1048972509 8:139653108-139653130 AGCCCAGTCCAGCTGCTCAGGGG + Intronic
1049269686 8:141687741-141687763 TACTTAATCCTGATACTCAGTGG + Intergenic
1052744433 9:32426339-32426361 AACTCAATCCTGCTGCTCAGGGG - Intronic
1052889692 9:33686933-33686955 CACTAAATCCTGCTCCTGAGAGG + Intergenic
1053153813 9:35759990-35760012 AAATCAATGCTGCCCCTCAGTGG - Intergenic
1055100463 9:72459611-72459633 AGCTCAATCTTGCTGCTGTGTGG - Intergenic
1055636177 9:78281445-78281467 AAGTCAGTCCTGCTGCTGTGGGG - Intergenic
1057023999 9:91722252-91722274 AACTCAGCCCTGCTGCTCCAGGG + Intronic
1057045250 9:91880861-91880883 CAGTGAATCCTGCTGCTCAAAGG + Intronic
1057330635 9:94111517-94111539 AACAAAATCCTGTTTCTCAGTGG + Intergenic
1060804215 9:126564532-126564554 AACTCATGCCTGCTGTTTAGGGG + Intergenic
1061012979 9:127966258-127966280 GTCTGAATCCTGCTGCTCACCGG + Intronic
1190464091 X:50708504-50708526 AACTCATTTCAGCTGCTAAGGGG + Intronic
1191698028 X:64009317-64009339 AACACAATGCAGATGCTCAGTGG + Intergenic
1192235408 X:69292346-69292368 AACACAGTCCCTCTGCTCAGAGG + Intergenic
1193406189 X:81105576-81105598 AGCCCAATCCTGGGGCTCAGAGG + Intergenic
1193646638 X:84078419-84078441 GACTCAATCATTCTGCTCATAGG + Intronic
1195246986 X:103003818-103003840 CACTCAGTCCAGCTGCTCAGAGG - Intergenic
1196499147 X:116358478-116358500 AAATCAATCCTGATAATCAGCGG + Intergenic
1196963589 X:121030723-121030745 AACTTCTTCCTGCTGATCAGGGG + Intergenic
1199463815 X:148113615-148113637 AAGTTAATGCTGCTGGTCAGTGG + Intergenic
1199905515 X:152225315-152225337 AACATAATTCTGCTGCTCACAGG + Intronic