ID: 1052746813

View in Genome Browser
Species Human (GRCh38)
Location 9:32449324-32449346
Sequence CCCCTACTGTACCCTGTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052746806_1052746813 2 Left 1052746806 9:32449299-32449321 CCTCAGTTCCATTCTTACCTCCC 0: 1
1: 0
2: 2
3: 37
4: 416
Right 1052746813 9:32449324-32449346 CCCCTACTGTACCCTGTTCCCGG No data
1052746807_1052746813 -6 Left 1052746807 9:32449307-32449329 CCATTCTTACCTCCCACCCCCTA 0: 1
1: 0
2: 3
3: 79
4: 743
Right 1052746813 9:32449324-32449346 CCCCTACTGTACCCTGTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052746813 Original CRISPR CCCCTACTGTACCCTGTTCC CGG Intronic
No off target data available for this crispr