ID: 1052747118

View in Genome Browser
Species Human (GRCh38)
Location 9:32451765-32451787
Sequence TAAATTACAAACAAACAGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6164
Summary {0: 1, 1: 0, 2: 8, 3: 234, 4: 5921}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052747117_1052747118 9 Left 1052747117 9:32451733-32451755 CCTGGGGATCTTATTTATATTCA 0: 1
1: 0
2: 3
3: 43
4: 397
Right 1052747118 9:32451765-32451787 TAAATTACAAACAAACAGCCAGG 0: 1
1: 0
2: 8
3: 234
4: 5921
1052747115_1052747118 24 Left 1052747115 9:32451718-32451740 CCCTGCACTTGCGGTCCTGGGGA 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1052747118 9:32451765-32451787 TAAATTACAAACAAACAGCCAGG 0: 1
1: 0
2: 8
3: 234
4: 5921
1052747116_1052747118 23 Left 1052747116 9:32451719-32451741 CCTGCACTTGCGGTCCTGGGGAT 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1052747118 9:32451765-32451787 TAAATTACAAACAAACAGCCAGG 0: 1
1: 0
2: 8
3: 234
4: 5921

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052747118 Original CRISPR TAAATTACAAACAAACAGCC AGG Exonic
Too many off-targets to display for this crispr