ID: 1052748450

View in Genome Browser
Species Human (GRCh38)
Location 9:32464362-32464384
Sequence TAGTAAAAGTATAACGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052748450_1052748453 7 Left 1052748450 9:32464362-32464384 CCTACCTCGTTATACTTTTACTA 0: 1
1: 0
2: 1
3: 9
4: 229
Right 1052748453 9:32464392-32464414 TTTTGTTTGTTTTTTTGAGACGG 0: 226
1: 2244
2: 95334
3: 76235
4: 96688
1052748450_1052748454 28 Left 1052748450 9:32464362-32464384 CCTACCTCGTTATACTTTTACTA 0: 1
1: 0
2: 1
3: 9
4: 229
Right 1052748454 9:32464413-32464435 GGAGTCTTACTCTGTTGCCCAGG 0: 572
1: 18618
2: 67136
3: 148479
4: 191124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052748450 Original CRISPR TAGTAAAAGTATAACGAGGT AGG (reversed) Intronic
901588927 1:10322841-10322863 TGGTGAAACTATAACGTGGTAGG + Intronic
905007932 1:34725996-34726018 CAGTGAAAGTATAAGGTGGTTGG - Intronic
906857113 1:49319891-49319913 CAGTAACAGTATTAAGAGGTGGG - Intronic
908040181 1:60104366-60104388 TCGTAACAGTATTAAGAGGTGGG + Intergenic
908237744 1:62163551-62163573 TAGTAAAAGTATATTGATGAAGG + Exonic
909683263 1:78316696-78316718 TACTAAACGGATAACCAGGTAGG + Intronic
910036846 1:82799054-82799076 TTGTAAGAATATAAAGAGGTGGG - Intergenic
910728724 1:90366950-90366972 TTGTAATAGTATTATGAGGTGGG + Intergenic
910892569 1:92032902-92032924 TTGTAACAGTATTAAGAGGTGGG - Intronic
911270455 1:95795411-95795433 TTGTAACAGTATTAAGAGGTGGG - Intergenic
911672250 1:100620350-100620372 TTGTAACAGTATTAAGAGGTGGG + Intergenic
915426839 1:155834299-155834321 TAGTAAAAGTGAAAAGAGGAAGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915797640 1:158753441-158753463 AAGTAGAAGTAAAAGGAGGTTGG - Intergenic
923442612 1:234035648-234035670 GAGTAAAAGCACAAAGAGGTAGG - Intronic
923556429 1:235004324-235004346 TTGTAACAGTATTAAGAGGTAGG + Intergenic
923859267 1:237876768-237876790 TTGTAACAGTATTAAGAGGTAGG + Intergenic
1063016193 10:2080108-2080130 TAGTAAAGGGATACAGAGGTTGG + Intergenic
1064173346 10:13053270-13053292 TAATAAAAGTACAAAGGGGTTGG + Intronic
1065075053 10:22070018-22070040 TTGTAATAGTATTAAGAGGTGGG + Intergenic
1065217494 10:23463415-23463437 TAGGAAAAATTTAACCAGGTTGG + Intergenic
1065423499 10:25574475-25574497 TAGTAAAAGGATAAGCAGTTTGG + Intronic
1065722764 10:28642498-28642520 TAGTAGAAGAAGAAAGAGGTAGG - Intergenic
1065881867 10:30043962-30043984 TTGTAACAGTATTAAGAGGTGGG + Intronic
1069344401 10:67450996-67451018 TTGTAACAGTATTAAGAGGTAGG + Intronic
1071194452 10:83141588-83141610 TAGTTCAAGAATAACAAGGTGGG + Intergenic
1071206963 10:83291223-83291245 TAGTCATAGAATAATGAGGTCGG - Intergenic
1071216698 10:83412289-83412311 TAGTAAAAGTATTAAAAAGTAGG - Intergenic
1075098245 10:119487819-119487841 AAGCAAAAGTATTAAGAGGTAGG + Intergenic
1075996590 10:126881846-126881868 TACTAAAAATACAAAGAGGTTGG + Intergenic
1078384749 11:10879779-10879801 TATTAAAAATATAACTAGGTGGG + Intergenic
1079775391 11:24519188-24519210 TAGTCAAAATATAAAGAGGATGG - Intronic
1080308250 11:30860209-30860231 GAGTAAAGGGATAACGAGCTGGG - Intronic
1082738867 11:56888087-56888109 TAGTAACAGTATTTAGAGGTGGG - Intergenic
1084965905 11:72744424-72744446 TAGTAGAACTATAACTGGGTGGG - Intronic
1086539964 11:87897271-87897293 TAATAAAAGTATCAGCAGGTAGG - Intergenic
1086556497 11:88117305-88117327 TAGCAAAAGCATAAAAAGGTTGG + Intronic
1087044676 11:93834841-93834863 GTGTAATAGTATAAAGAGGTGGG + Intronic
1087149359 11:94844747-94844769 TTGTAACAGTATTAAGAGGTGGG - Intronic
1087551470 11:99655799-99655821 TAGTAGTAGAATAAAGAGGTAGG + Intronic
1087831462 11:102823655-102823677 TAGAAAAAGTAGAGTGAGGTTGG - Intergenic
1088354189 11:108924934-108924956 TAGAAAATGTAGAAAGAGGTTGG + Intronic
1090122750 11:124049907-124049929 TAGTAAATGTTTAATGAAGTTGG - Intergenic
1090867293 11:130712523-130712545 TATTAAAGTTATAAAGAGGTTGG + Intronic
1092140464 12:6180131-6180153 TAGTTAAATTAAAATGAGGTTGG - Intergenic
1092875651 12:12845180-12845202 TAGTAAAGATAAAACGAGGCTGG - Intergenic
1093486664 12:19660315-19660337 TTGTAACAGTATTAAGAGGTGGG - Intronic
1095579127 12:43775728-43775750 TAGAAAAAGAATTACTAGGTAGG + Intronic
1096506921 12:52099494-52099516 TAGGAACAGTATCACGGGGTGGG + Intergenic
1098085460 12:66837822-66837844 TAGTAACAGAATAAAGAGGAAGG + Intergenic
1099181574 12:79476376-79476398 TAGAAACAGTATCACGAGGCGGG - Intergenic
1101165003 12:102020274-102020296 AAGTAAAGGTAGAATGAGGTGGG + Intronic
1101538843 12:105645915-105645937 TTGTAATAGTATTAAGAGGTGGG - Intergenic
1102917254 12:116763470-116763492 AACTAAAAGTAGAACTAGGTGGG + Intronic
1105718971 13:23095147-23095169 TTGTAACAGTATTAAGAGGTGGG + Intergenic
1106276507 13:28213532-28213554 TGGTAAAATTCAAACGAGGTGGG + Intronic
1106394904 13:29370274-29370296 TTGTAACAGTATTAGGAGGTAGG + Intronic
1106654038 13:31723061-31723083 TTTTAAGAGTATAAAGAGGTTGG - Intergenic
1108348814 13:49571781-49571803 TAGTCAAATTATAATGAGGATGG - Intronic
1110036615 13:70694228-70694250 TAGTGAATGTAAAACTAGGTTGG + Intergenic
1114232113 14:20792555-20792577 GTGTAAAAGTATTAAGAGGTGGG + Intergenic
1115147234 14:30239621-30239643 GAGTAAAAATATAAGGAGGAGGG - Intergenic
1116066379 14:39988426-39988448 TAGAAAAATTATAAATAGGTTGG - Intergenic
1118830266 14:69424897-69424919 TAAGAATAGTATAAAGAGGTAGG + Intronic
1120466858 14:84869395-84869417 TAGGAAAAGTAGAAAAAGGTAGG - Intergenic
1124431132 15:29609394-29609416 TTGTAACAGTATTAAGAGGTGGG + Intergenic
1125490166 15:40141433-40141455 TTGTAACAGTCTTACGAGGTAGG + Intergenic
1126185351 15:45825977-45825999 TTGTAATAGTATTAAGAGGTGGG + Intergenic
1132397419 15:101484308-101484330 TAGTAAAAGTATAAAAGTGTGGG - Intronic
1133741747 16:8657044-8657066 TTGTAACAGTATCAAGAGGTGGG - Intergenic
1134285662 16:12860096-12860118 TTGTAACAGTATTAGGAGGTGGG + Intergenic
1135976179 16:27110079-27110101 CTGAAAAAGGATAACGAGGTGGG + Intergenic
1136623386 16:31444935-31444957 TATAAAAAGGATAACCAGGTGGG + Intergenic
1138248800 16:55486933-55486955 TAGTAAAAGCATAAACAGGAAGG - Intronic
1138382483 16:56612387-56612409 TAATAAAATTATAGCTAGGTTGG - Intergenic
1138407082 16:56804743-56804765 TAGTAAAAATATAATTAGCTAGG + Intronic
1141277320 16:82600455-82600477 TTGTAACAGTATTAAGAGGTTGG + Intergenic
1143013841 17:3881315-3881337 AGGTAAAAGTATATAGAGGTGGG - Intronic
1143267330 17:5649641-5649663 AAGCAAAAATATAACAAGGTAGG - Intergenic
1143800396 17:9374765-9374787 CATTAAAAGAATAAAGAGGTTGG + Intronic
1146022807 17:29293480-29293502 TGGGAAAAGAATAATGAGGTTGG + Intronic
1146402000 17:32507100-32507122 TAGTAAAAGTAAAAATAGGCTGG + Intronic
1151032013 17:70752386-70752408 TACTGAAAGTATAAACAGGTTGG + Intergenic
1156047451 18:32892971-32892993 CAGTTAAAATATCACGAGGTTGG - Intergenic
1156069878 18:33194062-33194084 TTGTAACAGTATTAAGAGGTGGG - Intronic
1156110852 18:33725424-33725446 AAGCAAAAGTAGAAAGAGGTAGG - Intronic
1158826210 18:61223028-61223050 CAGTAACAGTATTAAGAGGTGGG - Intergenic
1163855159 19:19695926-19695948 AATTAAAAGCATAATGAGGTCGG - Intergenic
1165968683 19:39606462-39606484 TAGTACAAGTATTGGGAGGTTGG - Intronic
925806491 2:7655576-7655598 TAGACAAAGTATAACAAGGCCGG - Intergenic
926831731 2:16970757-16970779 TTGTAATAGTATTAAGAGGTGGG + Intergenic
927977179 2:27347751-27347773 TTGTAACAGTATTAAGAGGTGGG + Intronic
929853269 2:45612370-45612392 TTGTAATAGTATGAAGAGGTGGG - Intergenic
930693012 2:54383775-54383797 TTGTAACAGTATTAAGAGGTGGG + Intergenic
930886868 2:56335977-56335999 TTGTAACAGTATTAAGAGGTGGG - Intronic
931110763 2:59108839-59108861 TTGTAACAGTATTAGGAGGTGGG + Intergenic
931937794 2:67217385-67217407 TTGTAATAGTATGAAGAGGTGGG + Intergenic
932442422 2:71745992-71746014 TTGTAACAGTATTAAGAGGTGGG + Intergenic
932634331 2:73374917-73374939 AAGTAACAGTATTAAGAGGTGGG + Intergenic
935761307 2:106323119-106323141 TAGTAAAAAAACAATGAGGTAGG - Intergenic
938927545 2:136058025-136058047 TTGTAACAGTATTAAGAGGTGGG - Intergenic
939412424 2:141846237-141846259 TAATAAAAGAATAACCAAGTAGG + Intronic
940296692 2:152133014-152133036 TAGTAAAAGTATTACTTGGAAGG - Intronic
940523774 2:154785449-154785471 TTGTAACAGTATGAAGAGGTGGG + Intronic
941531705 2:166678617-166678639 GTGTAAAAGTATTAAGAGGTGGG + Intergenic
941944081 2:171075909-171075931 TAGTAAGAATATTAAGAGGTGGG + Intronic
942273646 2:174302043-174302065 AAGTAAAAATACAACTAGGTAGG - Intergenic
942513064 2:176723169-176723191 AAGTAATAGTATTAAGAGGTGGG + Intergenic
943107333 2:183561659-183561681 TTGTAACAGTATTAAGAGGTAGG - Intergenic
943520284 2:188941064-188941086 TACTAAGAGTATAATGAGCTTGG - Intergenic
943690828 2:190868235-190868257 TTGTAACAGTATTAAGAGGTGGG - Intergenic
943898879 2:193406380-193406402 TAGTAAAAGGATAATAAGTTGGG + Intergenic
943966432 2:194339833-194339855 CAGTAAAAGTAAAACTATGTAGG + Intergenic
944379707 2:199093681-199093703 TTGTAACAGTATTAAGAGGTGGG - Intergenic
944840719 2:203621287-203621309 AAGTAATAGTATTAAGAGGTAGG + Intergenic
945407877 2:209471656-209471678 TAATAAAAGAATAAAGAGGAAGG + Intronic
948417336 2:237820744-237820766 TAGTAAAATTAGAACCAAGTGGG + Intronic
1170822290 20:19765011-19765033 TACTAAAAGTACAACCTGGTAGG - Intergenic
1173093444 20:39999815-39999837 TTGTAAAAGAATAACAAAGTTGG + Intergenic
1175013947 20:55768306-55768328 TTGTAAAAGAATAAACAGGTCGG + Intergenic
1175811239 20:61859239-61859261 CAGTAAAAGAATAACGTAGTAGG - Intronic
1176997090 21:15568110-15568132 TCGTAACAGTATTAAGAGGTGGG - Intergenic
1177618231 21:23554202-23554224 TTGTAACAGTATTAAGAGGTAGG + Intergenic
1179360854 21:40706948-40706970 TAGTAAAAGCACAACTGGGTAGG + Intronic
1180653523 22:17399175-17399197 TAGTAAAAGGCTCAGGAGGTGGG + Intronic
949678167 3:6482033-6482055 TTGTAACAGTATTAAGAGGTGGG + Intergenic
949985173 3:9535095-9535117 TACTAAAAGTATACTGAGGAAGG + Intronic
950689208 3:14642240-14642262 TTGTAACAGTATTAAGAGGTGGG + Intergenic
951086074 3:18514577-18514599 TTGTAACAGTATTAAGAGGTAGG + Intergenic
951092446 3:18589987-18590009 CATTAAAAGTATAAAGAGGGAGG + Intergenic
954504611 3:51057499-51057521 AAGTAACAGTATAATTAGGTTGG - Intronic
954643370 3:52115575-52115597 AAGTAATAGTATTAGGAGGTGGG + Intronic
957855608 3:85873164-85873186 TTGTAACAGTATTAAGAGGTTGG - Intronic
958030705 3:88105847-88105869 TTGTAACAGTATTAAGAGGTGGG + Intronic
958133176 3:89455589-89455611 GAGCAAAAGTATGAGGAGGTGGG + Intronic
960335350 3:116411002-116411024 TCGTAACAGTATTAAGAGGTGGG + Intronic
964744207 3:159997194-159997216 TTGTAACAGTATAAAGATGTGGG - Intergenic
966086462 3:176073302-176073324 TATTAAAAATATTATGAGGTAGG - Intergenic
966216542 3:177508720-177508742 TAGTAACAGTATTAAGAAGTGGG + Intergenic
966430055 3:179821894-179821916 TAGGAAAAGTATGAAGAGGCAGG - Intronic
966468157 3:180255847-180255869 TGGTAACAGTATTAAGAGGTGGG - Intergenic
968410287 4:384548-384570 TAGTAACATTATAAGGAGCTGGG - Intronic
970212288 4:13722125-13722147 TTGTAACAGTATTAAGAGGTGGG + Intergenic
971435416 4:26617286-26617308 TTGTAACAGTATTAAGAGGTGGG - Intronic
972271460 4:37514292-37514314 TTGTAACAGTATTAAGAGGTGGG - Intronic
972774092 4:42225544-42225566 CAGTAACTGTCTAACGAGGTTGG - Intergenic
972865898 4:43232172-43232194 TAGCAAAAGGATGACTAGGTGGG + Intergenic
973329210 4:48895617-48895639 TTGTAACAGTATCAAGAGGTGGG - Intronic
975748511 4:77498060-77498082 AAGAAAAAGTATAGCTAGGTAGG - Intergenic
976396330 4:84559778-84559800 AATTAAAAGTATAACAAGGACGG + Intergenic
976764439 4:88584522-88584544 TTGTAACAGTATTAAGAGGTAGG + Intronic
977399697 4:96516864-96516886 TATTAAAAGGATAACAAGGGGGG + Intergenic
977529235 4:98180729-98180751 TTGTAACAGTATTAAGAGGTGGG + Intergenic
977532571 4:98217466-98217488 TAGAAAAAGTAAAACAAGGCTGG + Intergenic
977954379 4:103010425-103010447 TTGTAACAGTATCAAGAGGTGGG - Intronic
979435737 4:120687686-120687708 TTGTAACAGTATTAAGAGGTGGG + Intronic
979896434 4:126163827-126163849 TAGAAAAAGTATGAAAAGGTAGG - Intergenic
982104715 4:152001346-152001368 AATTAAAAATATAACTAGGTTGG - Intergenic
982495229 4:156083081-156083103 TTGTAACAGTATTAAGAGGTGGG + Intergenic
983848207 4:172545182-172545204 TACTAAATGTATAATGGGGTGGG + Intronic
984588945 4:181595132-181595154 TACTAAAAGTAGAACTAGGCTGG + Intergenic
984752678 4:183293717-183293739 TAGTAAGAGTTTAGCAAGGTGGG + Intronic
985967418 5:3348184-3348206 TAGCAGAAGTATAAGGAGGGAGG - Intergenic
987799261 5:22672370-22672392 TTGTAATAGTATTAAGAGGTAGG + Intronic
989005311 5:36804463-36804485 TTGTAAAAGTATTAAGAGGGTGG + Intergenic
990756559 5:59078483-59078505 TTGTAACAGTATTAAGAGGTAGG + Intronic
990802301 5:59618756-59618778 TTGTAACAGTATTAAGAGGTGGG + Intronic
990924222 5:61001245-61001267 AAGTAAAAGTATAAGGAGGTTGG - Intronic
992194666 5:74327369-74327391 CAGTAGAACTATAACGAAGTTGG + Intergenic
993645239 5:90453437-90453459 TGGTAACAGTATTAAGAGGTGGG - Intergenic
996572351 5:124945766-124945788 TAGTAACAGTATTAAGAGGTAGG + Intergenic
997753151 5:136369462-136369484 TTGTAATAGTATTAAGAGGTGGG + Intronic
997945763 5:138199713-138199735 TAGTAAAAGTCTATCAAGTTGGG + Intronic
998325827 5:141279093-141279115 GTGCAAAAGTATAACAAGGTTGG - Intergenic
1001127218 5:169030439-169030461 TAGTAAATGGATGACAAGGTAGG + Intronic
1002042436 5:176524449-176524471 TACTAAAAGTATAAAAAGCTGGG + Intergenic
1005699299 6:28383779-28383801 AAGTAAAAGTATACCTGGGTGGG + Intronic
1007055131 6:38875503-38875525 TAGTAAAATTAAAAGGAGGAAGG - Intronic
1008636823 6:53419117-53419139 AAGTAAAAGTATCAAGAAGTTGG + Intergenic
1009061426 6:58401612-58401634 TAGTAAAAGAAACAGGAGGTTGG - Intergenic
1009249093 6:61276164-61276186 TAGTAAAAGAAACAGGAGGTTGG - Intergenic
1010711394 6:79179367-79179389 TAGTAACAGTATTAAGAAGTGGG + Intergenic
1011375746 6:86684878-86684900 ATGTAAAAGTATTAAGAGGTGGG + Intergenic
1012048786 6:94312622-94312644 TAGTAAAAGAAAAATGAGGCCGG + Intergenic
1012411365 6:98961778-98961800 TTGTAACAGTATTAAGAGGTGGG + Intergenic
1012709226 6:102578211-102578233 TAGTAAAAGTTTAAGGAGCGGGG - Intergenic
1017506404 6:155072583-155072605 TTGAAAAAGAATAACGAGTTTGG + Intronic
1018879259 6:167860202-167860224 TTGTAAGATTATAACTAGGTTGG + Intronic
1019192527 6:170261437-170261459 TATAAAAAGTAAAACAAGGTCGG + Intergenic
1019832129 7:3341979-3342001 TAGTAAAAGAATAAAGCAGTTGG + Intronic
1020877636 7:13718009-13718031 TTGTAAAAGTATTAAGATGTGGG - Intergenic
1021805161 7:24348226-24348248 GAGCAAAAATATAAAGAGGTGGG - Intergenic
1021971753 7:25971614-25971636 TAGGAAGAGGATAACCAGGTGGG - Intergenic
1022237842 7:28479034-28479056 TTGGGAAAGTATAAAGAGGTGGG + Intronic
1022823599 7:33986287-33986309 TAGGAAAAGTAGAAAGAGATGGG - Intronic
1024517647 7:50273071-50273093 TAATAAATGTATAACGAGTTGGG + Intergenic
1027477689 7:78653848-78653870 TACTAAAAGTCTAATGAGGATGG - Intronic
1028210524 7:88068965-88068987 TTGTAACAGTATGAAGAGGTGGG + Intronic
1028264168 7:88702871-88702893 TTGTAAAAGTATTAAGAGGTAGG - Intergenic
1029633610 7:101768983-101769005 TAGAAAAACTAAAACTAGGTCGG + Intergenic
1030344535 7:108417490-108417512 TTGTAACAGTATGAAGAGGTGGG - Intronic
1030920014 7:115371777-115371799 TTGAAAAAGTATAACAAAGTTGG + Intergenic
1033708895 7:143917635-143917657 TAGTAAAAGTAATACCTGGTAGG + Intergenic
1033965873 7:146974641-146974663 TAGTAAAAGCATATTGATGTTGG + Intronic
1038330688 8:26606457-26606479 TAATAAAAGGATAACGAAGTAGG + Intronic
1039591611 8:38754719-38754741 TAGTAAAAGTATACTGAGGCTGG - Intronic
1040839175 8:51766123-51766145 TAGTAAAAGAATAAACAGCTCGG - Intronic
1041217353 8:55614112-55614134 TATTAAAAATATAACAATGTGGG + Intergenic
1043465649 8:80504039-80504061 TAGTAAGAGTAGAAAGAGGCAGG + Intronic
1043480295 8:80645906-80645928 TTGTAATAGTATTAAGAGGTGGG + Intronic
1043538144 8:81228625-81228647 TTGTAACAGTATTAAGAGGTAGG - Intergenic
1044303029 8:90607415-90607437 TTGTAACAGTATTAAGAGGTGGG + Intergenic
1044526119 8:93253389-93253411 TAGTAAAAGTAGAATGAAGTTGG + Intergenic
1044643114 8:94406347-94406369 TAGTAAAAGTACAAAGAGAAAGG + Intronic
1044791646 8:95853512-95853534 AAGTAATAGTATTAGGAGGTGGG - Intergenic
1045766908 8:105683143-105683165 AAGTAATAGTATTAGGAGGTAGG - Intronic
1047064299 8:121263261-121263283 TTGTAACAGTATTAAGAGGTGGG + Intergenic
1047935230 8:129769702-129769724 TTGTAACAGTATTAAGAGGTGGG - Intronic
1050042174 9:1507582-1507604 TAGTGAAAGTATAAAGAGAAGGG + Intergenic
1050755431 9:8996788-8996810 AAGTAAAAGTATTAAGAGGTAGG - Intronic
1052544420 9:29856357-29856379 AAGTAACATTATTACGAGGTGGG + Intergenic
1052748450 9:32464362-32464384 TAGTAAAAGTATAACGAGGTAGG - Intronic
1055073384 9:72189972-72189994 TTGTAACAGTATTAAGAGGTAGG + Intronic
1055188284 9:73484122-73484144 TAATAACAGTGTAACAAGGTTGG + Intergenic
1057134491 9:92677840-92677862 TCGTAACAGTATTAAGAGGTGGG - Intergenic
1057362303 9:94384771-94384793 TTGTAATAGTATTAAGAGGTGGG + Intronic
1057661038 9:97003332-97003354 TTGTAATAGTATTAAGAGGTGGG - Intronic
1058419785 9:104822591-104822613 TGGTAAAAGTCTACCGAGATGGG - Exonic
1185895762 X:3857541-3857563 TATTAAAAGTGTACTGAGGTCGG - Intergenic
1185900881 X:3895965-3895987 TATTAAAAGTGTACTGAGGTCGG - Intergenic
1185905996 X:3934404-3934426 TATTAAAAGTGTACTGAGGTCGG - Intergenic
1188128496 X:26400314-26400336 TTGTAACAGTATTAAGAGGTGGG + Intergenic
1189222780 X:39386579-39386601 TGGGAAAAGTATAAAGAGGTTGG - Intergenic
1190140001 X:47834652-47834674 TTGTAACAGTATTAGGAGGTGGG + Intergenic
1194979717 X:100427979-100428001 TATTATAATTATAAGGAGGTAGG - Intergenic
1195511552 X:105721551-105721573 TTGTAAAATTATAACCAGTTTGG - Intronic
1195654031 X:107317229-107317251 TGGTGAAAGTGTAACGAGGGAGG + Intergenic
1195851220 X:109283866-109283888 TAATAAAAGTATTAGGAGGAAGG - Intergenic
1198078733 X:133218637-133218659 TTGTAACAGTATTAAGAGGTAGG - Intergenic
1199312598 X:146338657-146338679 TATTAAAAGTAGAACCAAGTGGG - Intergenic