ID: 1052748758

View in Genome Browser
Species Human (GRCh38)
Location 9:32467426-32467448
Sequence GGGCCCCCTGTATTCAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052748758_1052748763 5 Left 1052748758 9:32467426-32467448 CCCTTCTTGAATACAGGGGGCCC 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1052748763 9:32467454-32467476 CCCACCAGCACCACCATGAAAGG No data
1052748758_1052748768 21 Left 1052748758 9:32467426-32467448 CCCTTCTTGAATACAGGGGGCCC 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1052748768 9:32467470-32467492 TGAAAGGTTTACATGTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052748758 Original CRISPR GGGCCCCCTGTATTCAAGAA GGG (reversed) Intronic
900472083 1:2860000-2860022 GTGCCCCCTGGAGTCAGGAATGG + Intergenic
904078156 1:27855325-27855347 GAGCCCCCTGTACTGAAGACAGG + Intergenic
905026986 1:34857290-34857312 GGGCCTCCTGAATTGAAGTAGGG + Intronic
907246095 1:53110056-53110078 GGGCCTCCTGTCTTCAAGGTTGG + Intronic
910700339 1:90067437-90067459 GGGCAGCAAGTATTCAAGAAAGG + Intergenic
912237584 1:107868394-107868416 GGGCCACCTATAGCCAAGAAAGG + Intronic
915092892 1:153438924-153438946 GGGCCCCCTGTGTTCGGGACAGG - Intronic
917086923 1:171312861-171312883 GGTCTCCCTGACTTCAAGAATGG - Intergenic
917821743 1:178769886-178769908 GAGGCCCCAGTATGCAAGAAAGG - Intronic
919895466 1:202007278-202007300 GGGTGCCCTGTATTTAAGAAAGG - Intergenic
923095565 1:230772829-230772851 TGGCCCCCAGTTATCAAGAAAGG + Intronic
1065574623 10:27105045-27105067 GGGCCCCTGGTACTCCAGAAGGG - Intergenic
1068485843 10:57657318-57657340 GTGCCCTCTGCCTTCAAGAAAGG - Intergenic
1069660820 10:70122355-70122377 TGGCCCCATTAATTCAAGAAGGG + Intronic
1071075414 10:81745605-81745627 GAGCTCCCTGTGTTCAAGTAGGG + Intergenic
1074087966 10:110223021-110223043 AGGCCACCTGCATTGAAGAAGGG - Intronic
1075440475 10:122476052-122476074 GGGCCTCCTGTCTGCAAGAGGGG - Intronic
1079004214 11:16781002-16781024 AGGCCCCCTGTCTTCCAGGACGG - Intronic
1081271733 11:41093568-41093590 GGGCCCAGTGTTTTCAAGAGAGG - Intronic
1083865947 11:65453040-65453062 GGGCCCTTTGTCTCCAAGAATGG + Intergenic
1085967366 11:81544058-81544080 GGGGCACCTGTATTAAAGGAAGG + Intergenic
1086658739 11:89388439-89388461 TGGCCCCCTGACTTCAAGACAGG + Intronic
1091400630 12:178638-178660 GGAACCCCTGTCTTCAATAAAGG + Intergenic
1091829722 12:3540925-3540947 GGGCCCCCCGGATTGGAGAAAGG - Intronic
1092062829 12:5564936-5564958 GTGCCCCCGGTCTTCAAGCAGGG - Intronic
1093651933 12:21656512-21656534 GGGCCCCCTGTATACCAAAACGG - Intronic
1096542163 12:52313944-52313966 GGGGACCGTGTATGCAAGAAGGG + Intergenic
1100644057 12:96510458-96510480 GGGCCCTCTGTATTTCAAAAAGG - Intronic
1100665760 12:96751237-96751259 GGGCCACTTATATGCAAGAATGG + Intronic
1102544566 12:113645475-113645497 ATGCCTCCTGAATTCAAGAAGGG + Intergenic
1110319258 13:74141640-74141662 GGGGCAGCTGTATTTAAGAAAGG - Intergenic
1114439562 14:22735215-22735237 GGGCTCCCTTTCTTCTAGAATGG - Intergenic
1122055929 14:99098277-99098299 GGGCCCAGTGTATTCAAGGAGGG - Intergenic
1122579176 14:102761038-102761060 GGGCCCCCTTTCTTCAAGGCGGG + Intergenic
1122741115 14:103872082-103872104 GGGCCCTCTGGACTCAGGAAAGG - Intergenic
1125466331 15:39956666-39956688 TGGCCCCCTGTACACCAGAAAGG + Intronic
1126478942 15:49096399-49096421 GGGTCACCTGTAGTCAAGAGTGG - Intergenic
1140425128 16:74854677-74854699 TGGGCCCCTGTATTCAGAAATGG - Intergenic
1140512409 16:75517551-75517573 GCGCCCCCTGTAGGAAAGAAGGG + Intergenic
1147799715 17:43075514-43075536 AGGCCCCCTGGATTGAAGATGGG + Intronic
1151654711 17:75490487-75490509 GGGCCCTCTCCATTCCAGAAGGG + Intronic
1153810075 18:8744757-8744779 CAGCCCCCTTTATTCAAGACGGG + Intronic
1154296702 18:13157641-13157663 GGGCCTCCCCCATTCAAGAAGGG - Intergenic
1155773059 18:29724767-29724789 TGGCCCCCTGTAGTCATGACTGG + Intergenic
1155839222 18:30626819-30626841 GGGCCACCTCTATTCAAGCGAGG - Intergenic
1159021923 18:63150366-63150388 GGGCCCACAGTATTGAAGATAGG - Intronic
1160343828 18:78112876-78112898 AGGCCCTCTGTGTACAAGAAAGG - Intergenic
1165833781 19:38742805-38742827 GGTGCCACTGTATTCCAGAATGG + Intronic
928207419 2:29296001-29296023 GGGCCATCTTTATTCAAGTACGG + Intronic
940021461 2:149160504-149160526 GGGCCCCATCTAATTAAGAATGG - Intronic
940601024 2:155860628-155860650 GGCCCAACTGTTTTCAAGAATGG - Intergenic
941739367 2:169016550-169016572 GTCCCCTCTGTATTCAGGAATGG - Intronic
1179109426 21:38433666-38433688 GGGCCTCATTTATCCAAGAACGG + Intronic
1179829670 21:43988775-43988797 GGGGCCACTTTCTTCAAGAAGGG - Intergenic
1181441917 22:22941244-22941266 GGCCCCCCTGCATCCACGAAAGG + Intergenic
952196919 3:31085443-31085465 GTGCCCCACGTAGTCAAGAAGGG + Intergenic
953272676 3:41460677-41460699 AGGCCCCCTGTAAACAAAAAAGG + Intronic
969571881 4:8013902-8013924 GGGCCCCGTGTTTCCAAGAGAGG + Intronic
977732165 4:100366633-100366655 GGGCCCCATTTCTTCAAGGAGGG + Intergenic
979367207 4:119839774-119839796 GGGCCCACTGTACTCCAGTATGG + Intergenic
997098127 5:130937132-130937154 GGGACCCCTGTATTAGAGGAAGG - Intergenic
997249112 5:132375216-132375238 GTGCCCCCTGTATAGAAGAGAGG - Intronic
999865187 5:155693677-155693699 TGGACCCATGTATTCAAGAAGGG + Intergenic
1001374939 5:171247339-171247361 GGGCCCTGTGTCATCAAGAAAGG + Intronic
1002676606 5:180919365-180919387 GGACCCCCTCTTCTCAAGAAAGG - Intronic
1004189652 6:13452532-13452554 GCGCCCCCTGTAAACAGGAAGGG - Intronic
1008814948 6:55554114-55554136 GTGCCCCCTGTATTCACTTATGG - Intronic
1015032569 6:128613507-128613529 GGTCTCCCTGACTTCAAGAATGG + Intergenic
1022262915 7:28724007-28724029 GGGCACCCTGTATAGAAGCACGG + Intronic
1033535661 7:142309621-142309643 GGGCTCCTTCTCTTCAAGAAGGG + Intergenic
1035046636 7:155972091-155972113 GGGCCATTTGTATCCAAGAAGGG + Intergenic
1041612403 8:59867069-59867091 GGGCACACTGTATTGAACAACGG + Intergenic
1052748758 9:32467426-32467448 GGGCCCCCTGTATTCAAGAAGGG - Intronic
1054948469 9:70822926-70822948 GGGCCCGGTGTTTTCATGAATGG + Intronic
1055355634 9:75434409-75434431 AGGTCCCCTTTAGTCAAGAATGG + Intergenic
1056395865 9:86180573-86180595 GGACCACATGTATACAAGAAAGG - Intergenic
1187726094 X:22203603-22203625 TGGCCCCCTAGATTCTAGAATGG + Intronic
1188244070 X:27820368-27820390 GGGCCCCATGGATTCATGACAGG + Intronic
1201602809 Y:15749315-15749337 GGTCTCCCTGACTTCAAGAATGG - Intergenic