ID: 1052748759

View in Genome Browser
Species Human (GRCh38)
Location 9:32467427-32467449
Sequence AGGGCCCCCTGTATTCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052748759_1052748763 4 Left 1052748759 9:32467427-32467449 CCTTCTTGAATACAGGGGGCCCT 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1052748763 9:32467454-32467476 CCCACCAGCACCACCATGAAAGG No data
1052748759_1052748768 20 Left 1052748759 9:32467427-32467449 CCTTCTTGAATACAGGGGGCCCT 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1052748768 9:32467470-32467492 TGAAAGGTTTACATGTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052748759 Original CRISPR AGGGCCCCCTGTATTCAAGA AGG (reversed) Intronic
904417256 1:30370876-30370898 TGGGCCCCATGTAATCACGAGGG - Intergenic
904420059 1:30385508-30385530 AGGGCCCCCTGAGTTCACAATGG + Intergenic
905026985 1:34857289-34857311 AGGGCCTCCTGAATTGAAGTAGG + Intronic
905169078 1:36099116-36099138 AGGGCCCCCAGGATTCCAGGGGG - Exonic
905587520 1:39132554-39132576 ACAGCCCCCTGTATTGAAAACGG + Intronic
917623532 1:176822378-176822400 TGGGCCCCCTATATTCTACAAGG - Intronic
920527617 1:206679367-206679389 ATATCCACCTGTATTCAAGAAGG - Intronic
921311912 1:213853052-213853074 TGGGCCCCTTGTGTTCCAGAGGG - Intergenic
922677771 1:227563313-227563335 AGTGCGCCCTTTATTAAAGATGG + Intergenic
924591998 1:245413038-245413060 ATGGTCCCCTGTAATCAAGATGG + Intronic
1064983074 10:21183467-21183489 AGGGCCCCATGAATTCAGGGAGG + Intergenic
1070522586 10:77267292-77267314 AGGACCCACTGTCTTCAAAAAGG + Intronic
1071075413 10:81745604-81745626 AGAGCTCCCTGTGTTCAAGTAGG + Intergenic
1074087967 10:110223022-110223044 AAGGCCACCTGCATTGAAGAAGG - Intronic
1075440476 10:122476053-122476075 GGGGCCTCCTGTCTGCAAGAGGG - Intronic
1075530976 10:123229571-123229593 AGAGCTCCCTGTAGACAAGATGG + Intergenic
1077532563 11:3104021-3104043 AGGGGGCCCTGTCTCCAAGATGG - Intronic
1078430550 11:11285003-11285025 AGGGCCCCTTGGACTGAAGATGG + Intronic
1078805033 11:14690637-14690659 AAGGCCCCCTAAATTCTAGAAGG + Intronic
1080834767 11:35929930-35929952 GGGGCCCCCTGTAAGCCAGAAGG + Intergenic
1085352238 11:75806253-75806275 AGGGCAGACTTTATTCAAGAGGG - Intergenic
1093231080 12:16542745-16542767 AGGCCACCCTGTATTCCAGTTGG + Intronic
1096406181 12:51346036-51346058 AGGCACCCCTGTTTTCAAAAGGG - Intronic
1102693621 12:114781080-114781102 AGGGCCCCTTGGATTCAAAATGG - Intergenic
1113967833 13:114164427-114164449 AGGCCCCTCAGTATTGAAGACGG - Intergenic
1119773279 14:77234680-77234702 AGGGCCCACTTTATTCTACATGG - Intronic
1122055930 14:99098278-99098300 GGGGCCCAGTGTATTCAAGGAGG - Intergenic
1122579175 14:102761037-102761059 CGGGCCCCCTTTCTTCAAGGCGG + Intergenic
1127774299 15:62253454-62253476 AGGTCCTCATGTATTCATGAAGG - Intergenic
1128143971 15:65322115-65322137 AGGGCTCCTTGGACTCAAGAGGG - Intergenic
1128646687 15:69383540-69383562 CGGGCCCTCTGTATTCATGGTGG + Intronic
1128646715 15:69383661-69383683 CGGGCCCTCTGTATTCATGGTGG + Intronic
1128646792 15:69383992-69384014 CGGGCCCTCTGTATTCATGGTGG + Intronic
1133566213 16:6996207-6996229 AAGCCTTCCTGTATTCAAGATGG - Intronic
1137755399 16:50898180-50898202 TGGGCCCCTTCTATTCTAGAAGG + Intergenic
1139012357 16:62648455-62648477 AGGGCCACCTCTATTCAATCTGG + Intergenic
1140512408 16:75517550-75517572 AGCGCCCCCTGTAGGAAAGAAGG + Intergenic
1140535731 16:75707961-75707983 AGGGCCCACTGTTCTCAAGTGGG + Intronic
1142751207 17:1988953-1988975 AGGGGCCCCTGTTTTTAACAGGG - Intronic
1143055920 17:4161738-4161760 AGGGCCACCTGTACTGGAGAGGG - Intronic
1146123058 17:30211635-30211657 AGGGCACACAGTTTTCAAGATGG - Intronic
1147799714 17:43075513-43075535 TAGGCCCCCTGGATTGAAGATGG + Intronic
1148391212 17:47274586-47274608 AGGGGCATGTGTATTCAAGAGGG - Intronic
1149856299 17:60085978-60086000 AGGGGCCCCTGGATTCAGCAGGG + Intergenic
1151519823 17:74619937-74619959 AGGGCCTTCTGCATTCATGATGG + Intronic
1151991515 17:77577979-77578001 AGGGCCTCCTGTAGTCCAGTAGG + Intergenic
1153810074 18:8744756-8744778 ACAGCCCCCTTTATTCAAGACGG + Intronic
1157191986 18:45589392-45589414 AGGGCCCTTTGTTTTCAACATGG + Intronic
1166453921 19:42924332-42924354 TGGGAGCCCTGTATGCAAGATGG + Exonic
1166472329 19:43088953-43088975 TGGGAACCCTGTATGCAAGATGG + Intronic
1166483460 19:43192902-43192924 TGGGAGCCCTGTATGCAAGATGG + Exonic
1167752001 19:51387183-51387205 AAGGACACCTGTATTCCAGATGG - Exonic
925113188 2:1353549-1353571 ACGGCCCCGTGAATTCAAGGAGG - Intronic
926230942 2:11003381-11003403 AGGGCCCACTCTATTCCAGGAGG - Intergenic
935327942 2:101954910-101954932 AGGGCTATCTGTATTCCAGATGG + Intergenic
939635791 2:144581247-144581269 AGGGACAGCTGTATTAAAGAGGG - Intergenic
943070441 2:183135073-183135095 AGGGCCCAATGTATTCACAAGGG - Intronic
1174575675 20:51535419-51535441 AGGCCCCACTGTCTTCAAGGGGG - Intronic
1175189114 20:57199283-57199305 AGGGCAGCCTGTTTACAAGATGG - Intronic
1182003426 22:26939666-26939688 AGAGCCCTCTGTTGTCAAGATGG - Intergenic
1184879963 22:47298444-47298466 AGGTCCACCCATATTCAAGAGGG + Intergenic
951202448 3:19890332-19890354 AGGGCTCCAGGTCTTCAAGAGGG + Intronic
952936204 3:38400188-38400210 AGTGCCCCCTGTATGCCAGATGG + Intronic
952960987 3:38588971-38588993 AGGGACCCCTGAAGTCAGGAGGG - Intronic
959079088 3:101780787-101780809 AGGGCCCCATGTATTCATGGAGG - Intronic
960595924 3:119407834-119407856 AGGGCCCACTGTATATAAAAAGG - Intronic
963029222 3:140951028-140951050 AGGGCACCAAGTATTCAAGAGGG - Intronic
964526489 3:157620391-157620413 ATGGCCCACTGCATTCATGAAGG + Intronic
978861523 4:113455801-113455823 AGGCCACCCTGTATTCCAAATGG - Exonic
980025849 4:127765528-127765550 CAGGCACCCTGTATTCCAGAAGG - Intronic
981478512 4:145212063-145212085 AGGGCTCACTGAATTCCAGATGG - Intergenic
986809911 5:11346083-11346105 AGTTTCCCCTGTATTAAAGACGG + Intronic
989977454 5:50603038-50603060 AGGTGCCCCTGTTTTCAACAGGG + Intergenic
990190900 5:53259454-53259476 ATGGCTCCCTTGATTCAAGATGG - Intergenic
990659369 5:57995908-57995930 AGGGCTCCCTGACTTCAGGAGGG + Intergenic
995105067 5:108368055-108368077 ATGGCCTCTTTTATTCAAGAAGG - Intronic
999865186 5:155693676-155693698 CTGGACCCATGTATTCAAGAAGG + Intergenic
1006262581 6:32887584-32887606 AGGACCCCCTGCATTCCAGAGGG + Intergenic
1008141831 6:47840610-47840632 AGGGCTCTCTGCTTTCAAGATGG - Intergenic
1011127000 6:84018770-84018792 AGGGGCACCTGTCTTCAAGAAGG + Intergenic
1011522630 6:88226013-88226035 AGGGCCCCATGTGTTGAAAACGG + Intergenic
1012354694 6:98299353-98299375 AGGGTCTCCTGTGTTCAGGAAGG - Intergenic
1015924644 6:138296655-138296677 AGGGAGCCCTGGATTCAAGAAGG - Intronic
1017589162 6:155959927-155959949 AGGTTCCCCTGGACTCAAGATGG + Intergenic
1019010654 6:168841556-168841578 AGGTCCCCCTGGAGTCAGGAGGG + Intergenic
1021827675 7:24571774-24571796 TGGGCCCCCTGTAGTCAGGATGG - Intergenic
1023473471 7:40551090-40551112 CAGGCCCTCTGTATTCAAGTGGG + Intronic
1024209515 7:47191720-47191742 AGTGCTCCATGTATTGAAGAAGG - Intergenic
1030075802 7:105735430-105735452 AAGGCACACTTTATTCAAGAGGG + Intronic
1033455709 7:141501617-141501639 AGGCCCACCTGTATTACAGAGGG - Intergenic
1039090213 8:33819925-33819947 AGGCCCACCTGTATTGAGGAGGG + Intergenic
1039848915 8:41345599-41345621 AGAACCCCATGTTTTCAAGAGGG + Intergenic
1044950234 8:97428784-97428806 AGGGTCTCCTGCATTGAAGAGGG + Intergenic
1047340233 8:123974147-123974169 AAGGCCCCCTATCTTCAACAGGG + Intronic
1047349075 8:124056051-124056073 TGGGCCCCATGTATTCTTGAGGG - Intronic
1047416552 8:124668874-124668896 AAGGGCCCCTGTGTACAAGAAGG - Intronic
1048299819 8:133243288-133243310 AGGGACGCCTGTGTTCGAGATGG + Intronic
1049455326 8:142683606-142683628 TGGGCCCCCAGTGTTCAGGAGGG - Intergenic
1051221832 9:14857177-14857199 TGGACCCCCTGATTTCAAGAAGG + Intronic
1051541726 9:18227558-18227580 AGGCCCCACTCTATGCAAGATGG + Intergenic
1052748759 9:32467427-32467449 AGGGCCCCCTGTATTCAAGAAGG - Intronic
1057029944 9:91767967-91767989 AGGGCCCTCTCTAATCAAGTAGG - Intronic
1062187558 9:135226855-135226877 AGAGCCCCCTGTGTCCTAGAGGG + Intergenic
1186338958 X:8622776-8622798 TGTGCCCCCTGTATTCCATAGGG + Intronic
1190144405 X:47877332-47877354 AGGCCTCCCTGTTTCCAAGAGGG - Intronic
1190188184 X:48254228-48254250 AGGGCCCACTGTGTTCATCAGGG - Intronic
1195220244 X:102739485-102739507 AGGAGCCCTTGTATTCAAGAGGG + Intronic