ID: 1052748760

View in Genome Browser
Species Human (GRCh38)
Location 9:32467446-32467468
Sequence GGTGGTGCTGGTGGGCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 420}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052748760_1052748768 1 Left 1052748760 9:32467446-32467468 CCCTTCAGCCCACCAGCACCACC 0: 1
1: 0
2: 3
3: 47
4: 420
Right 1052748768 9:32467470-32467492 TGAAAGGTTTACATGTTGACTGG No data
1052748760_1052748769 22 Left 1052748760 9:32467446-32467468 CCCTTCAGCCCACCAGCACCACC 0: 1
1: 0
2: 3
3: 47
4: 420
Right 1052748769 9:32467491-32467513 GGCAAAGCTTCAATCCAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052748760 Original CRISPR GGTGGTGCTGGTGGGCTGAA GGG (reversed) Intronic
900550620 1:3252610-3252632 GGTGGGGCTGGTGGGCAGCAGGG + Intronic
901005966 1:6171673-6171695 GGAGGGACTGGTGGGCTCAAGGG - Intronic
901261623 1:7875781-7875803 GGTAGTGATGGTGGGCGGAGTGG - Intergenic
901700624 1:11043278-11043300 GGGGGTGCAGCTGGGCTGAGGGG + Intronic
905205546 1:36341020-36341042 AGAGGGACTGGTGGGCTGAAAGG + Exonic
906142398 1:43541379-43541401 GGTGGTTAGGGTGGGCTGCATGG + Intronic
906157481 1:43622223-43622245 GGTGGGTCTGGTGGACAGAAGGG - Exonic
906700261 1:47852517-47852539 GGTGGCCCTGGTGGGCTGCAGGG - Intronic
907303399 1:53501730-53501752 GGTGGGGCTGGTGGTCTCAGTGG + Intergenic
907767051 1:57422831-57422853 GGTGGTGCTGGTGGGCCTGATGG - Intronic
908110200 1:60889043-60889065 GGTGGTGCTGGGGGTGGGAAGGG - Intronic
909263353 1:73524208-73524230 GCTGGTGCTGGTGGTGTTAAAGG - Intergenic
910401698 1:86843728-86843750 GGTGGTGGGGGTGGGGTGTATGG + Intergenic
910888771 1:91995095-91995117 CTTGGTTCTGGTGGGTTGAAGGG + Intronic
913334414 1:117695995-117696017 GTTGGTGCTGATTGGCTGATTGG + Intergenic
915981262 1:160421214-160421236 GGAGGTGCTTGTTGGGTGAATGG + Intronic
916562608 1:165946134-165946156 GGTGGTGGTGGTGGTGGGAACGG + Intergenic
918139735 1:181710189-181710211 GGTGGTGGGGGTGGGGTGGAGGG - Intronic
918247876 1:182675753-182675775 GGTGGTGCTATTGGGATGGAGGG - Intronic
918597704 1:186311057-186311079 GCTGGAGATGGTGGACTGAATGG - Exonic
918808444 1:189081268-189081290 TGTGGAGGTGGGGGGCTGAATGG + Intergenic
920173998 1:204088919-204088941 GGAGATGCTGGTGGGTTGAGGGG + Intronic
920730412 1:208478283-208478305 GGTGGTATTGGTGGGCTCAAGGG + Intergenic
921948406 1:220904909-220904931 GGTAGTGCTGGTGAGCCCAAGGG + Intergenic
922022446 1:221718131-221718153 GGGGGTGGGGGTGTGCTGAAAGG + Intronic
923447591 1:234087115-234087137 GGTATTGCTGGTGGCCAGAAAGG - Intronic
1062860791 10:807649-807671 GGTGGAGCTGGAGGGCCGCAGGG - Exonic
1067906350 10:50294962-50294984 GGTGGTGCTGGTGGCTGCAATGG - Intergenic
1069552998 10:69377357-69377379 GGTGGGGGTGATGGGCTGATGGG - Intronic
1070683337 10:78464613-78464635 GGAGGTGCTGGTGGTCTGCAAGG + Intergenic
1071358507 10:84821777-84821799 GATGATGCTGGAGGCCTGAATGG + Intergenic
1071491343 10:86138742-86138764 GATGGTTCAGGTGGGCTGCAGGG - Intronic
1073917997 10:108428338-108428360 GGTGGTGCTGATGTGGGGAAAGG - Intergenic
1074582082 10:114729306-114729328 GGTGGTGCTGCCAGGCTGAGTGG - Intergenic
1074851133 10:117440495-117440517 GGTGTGGCTGGAGGGCTGGAGGG + Intergenic
1075719548 10:124576707-124576729 GGGGGTACTGGGGGGCTGAGGGG + Intronic
1075778572 10:125003141-125003163 AGTGGTGCCGGTGGGCTGCACGG - Intronic
1075849406 10:125574855-125574877 GAAGGTGATGGTGGGCTGAAAGG + Intergenic
1077176178 11:1191929-1191951 GGTTGTGCTGGTGGTGGGAACGG - Intronic
1077289044 11:1780422-1780444 GATTTTGCTGGTGGGCTGGATGG + Intergenic
1077326679 11:1967006-1967028 GGAGGTGCTGGGGGGCTGCAGGG + Intronic
1077433703 11:2528239-2528261 CCTGGAGCTGGTGGTCTGAAAGG + Intronic
1078066656 11:8083191-8083213 GGCGGTGCTTGTGGGCTGAGTGG + Intronic
1078081775 11:8209374-8209396 GGAGGTGCTGGTGTCCTGATGGG - Intergenic
1078595087 11:12679132-12679154 GGTGGTGGTGGTGGGGAGTAGGG + Intronic
1081870164 11:46379701-46379723 GGAGGAGCTGGTGGGCAGAGAGG + Intronic
1083750750 11:64759391-64759413 GTGGGTGCTGGTGGGCAGGACGG - Intronic
1084484058 11:69437892-69437914 GGTGGGTCTGGGGGGCAGAAAGG + Intergenic
1084941868 11:72617302-72617324 GGTAGGGCTGGTGGGGTGGATGG + Intronic
1084958587 11:72704245-72704267 GGGGCTGCTGCTGGGCTGCAGGG + Exonic
1086700782 11:89898377-89898399 GGGGGTGCTTGTGGGTTGAGAGG + Intergenic
1086705387 11:89946150-89946172 GGGGGTGCTTGTGGGTTGAGAGG - Intergenic
1087025895 11:93649584-93649606 GGTAGTGCTGGTGGTGAGAATGG + Intergenic
1088173098 11:107018793-107018815 GGCGGCGCTGGTGGGGAGAAGGG + Intergenic
1088489296 11:110371335-110371357 GGTGGTGGTGGTGGGGTCAAGGG + Intergenic
1089108372 11:116034378-116034400 GGTGGTGCTGGTGGGCGGTGAGG + Intergenic
1089609232 11:119660318-119660340 GATGGTGCTGGTGGGGAGAGCGG + Intronic
1089683970 11:120135120-120135142 TGTGGTTCTGGTGGGCAGGAGGG - Intronic
1090044025 11:123315351-123315373 GGAGGGGCTGAGGGGCTGAAAGG - Intergenic
1091004314 11:131938707-131938729 GGTGGTGGTGGTGGTGTGGAAGG + Intronic
1091095746 11:132820627-132820649 GGATGTGCTGGTGGGAAGAAAGG + Intronic
1202809660 11_KI270721v1_random:22186-22208 GGAGGTGCTGGGGGGCTGCAGGG + Intergenic
1091537960 12:1430883-1430905 AGTGATGCTGAGGGGCTGAAGGG + Intronic
1094749180 12:33385755-33385777 AGTGGTGATGGTGGCTTGAATGG - Intronic
1095424437 12:42060455-42060477 AGTGGTGGGGGTGGGATGAAGGG - Intergenic
1095947854 12:47763954-47763976 GGTGGTGATGCTGGGCTGGAGGG + Intronic
1096184106 12:49567199-49567221 GCTGGTGCTGCTGAGCTGAGTGG - Intronic
1097046696 12:56191978-56192000 GGTGGTGGTGGTAGACTGACAGG - Intergenic
1097189418 12:57212407-57212429 GGTGAAGTTGGTGGGCTGCAGGG - Exonic
1097197386 12:57250804-57250826 GGGGGTGGGGGTGGGGTGAAGGG - Intronic
1099076988 12:78122085-78122107 GGCAGTGCTGGTGGGCTAAGCGG + Exonic
1100873046 12:98932214-98932236 GGTGGAGCTGCAGGGCTGATTGG - Intronic
1101064146 12:101002031-101002053 GGTGGTGATGGTGGGCAGCGAGG - Intronic
1101270575 12:103139701-103139723 GGTGGTACTGGAGGGCTTAGGGG + Intergenic
1101471973 12:105006063-105006085 GGTGGGGCAGGTGGAGTGAAGGG - Intronic
1101493669 12:105234074-105234096 GATGGTGCTGTTGTGCAGAATGG - Intronic
1101863677 12:108503515-108503537 GGTGGTGGTGAGGGGCTGGAGGG + Intergenic
1102013646 12:109634233-109634255 GGTGGTGATGGTGGTCACAATGG - Intergenic
1102014038 12:109636225-109636247 GGTGATGATGGTGGCCTTAATGG - Intergenic
1102037946 12:109782882-109782904 GGTGGTGGTGGTGGCCTGAGAGG - Intergenic
1102140926 12:110614212-110614234 GGTGGTGCTCCTGGGCTGCTGGG + Exonic
1104480017 12:129099567-129099589 GTTGCTGTTGGTGGGCTGAAGGG - Intronic
1104704817 12:130935210-130935232 GGTGGTGATGGTGAGAAGAAAGG + Intergenic
1104952024 12:132445463-132445485 GGTGGTGCTGGCTGGCAGAGTGG - Intergenic
1106074436 13:26445480-26445502 GGTGGTGGTGGTGGTGTAAATGG + Intergenic
1107225648 13:38044957-38044979 GGTGGCGATGGTGTGCTGGAGGG - Intergenic
1109663697 13:65500823-65500845 GGTAGTGCTGGTTAGATGAAAGG + Intergenic
1110277100 13:73652789-73652811 GTTGGGGTTGGTGGGGTGAAGGG + Intergenic
1110964817 13:81680110-81680132 GGTGGGGTTGGAGGGATGAAAGG - Intergenic
1113894551 13:113755312-113755334 GGTGGTGCTGGCGGGAAGGAAGG + Intergenic
1114652573 14:24295487-24295509 GGAGGTGCTGGGGGGCTGTCAGG + Intronic
1116180370 14:41524529-41524551 GATGGTGTTGGTGGGCAGAGAGG - Intergenic
1117592870 14:57292759-57292781 GGTGGTGGTGGTAGGGGGAAAGG - Exonic
1117881326 14:60316210-60316232 GGTGGGCCTGGTGGGCTGGTGGG - Intergenic
1118600659 14:67469660-67469682 GGTGGTGGTGGTGGGAGGACAGG + Intronic
1118725548 14:68626249-68626271 GATGGTGTTGGTGGGATGCAGGG + Intronic
1120704848 14:87735211-87735233 GGTGCAGCGGGGGGGCTGAAGGG + Intergenic
1121410467 14:93745474-93745496 GCTGGGGCTGGGGGCCTGAAAGG - Intronic
1121646846 14:95524280-95524302 GGTGGTGCAGGTGCCCTGCATGG - Intergenic
1121791739 14:96704313-96704335 GGTGGTGGTGGTGGGATGCAGGG + Intergenic
1121957526 14:98227701-98227723 GGCAGTGCTGGTGAGCTGAAGGG - Intergenic
1122157984 14:99762055-99762077 GGTGGGGCTGATGGGCTCAGTGG + Intronic
1122901327 14:104783506-104783528 GGTGGTGTTGGGGGGGTGACTGG - Intronic
1124856131 15:33391128-33391150 GGTGGGGCTGGAGGGATGAGGGG - Intronic
1124957051 15:34366731-34366753 GGTGGGGATGGAGGGCTGCAGGG - Intronic
1125125536 15:36215728-36215750 GGTGGTGCTGCTGGAATAAAAGG - Intergenic
1126798824 15:52282161-52282183 GTTGGTGCTGGTGTGGTGAGGGG - Intronic
1127099340 15:55548974-55548996 GGTGGTGATAGTGGACTGGATGG - Exonic
1127453896 15:59140867-59140889 GGTGGTGGTGGTGGGAGGAGTGG - Intronic
1128337815 15:66798690-66798712 GGTGATGCTGGAGGACTGAGGGG + Intergenic
1128644055 15:69361949-69361971 GGTGGTGATGGTGGGGGGACTGG + Intronic
1128892626 15:71344448-71344470 GGTGGAAGTGGTGAGCTGAATGG - Intronic
1129846577 15:78770577-78770599 GGGGGTACTGGAGGGCTGGAGGG + Intronic
1131057966 15:89387302-89387324 GCTGCTGCTGGTGGGCAGGATGG + Intergenic
1131272740 15:90956990-90957012 TGTGGGGCTGGCGGCCTGAACGG - Intronic
1132117115 15:99145583-99145605 GGTGGTGGTGGTGGGCTCACAGG + Intronic
1132935139 16:2475978-2476000 GGAGGTGCAGGTGGGCTGTTAGG + Intronic
1133269058 16:4601826-4601848 GGTGGTGCTGGGGAGTTGAGGGG + Intergenic
1133421434 16:5650336-5650358 GGTGGTGGTGGTGGTGTGGAGGG + Intergenic
1135434964 16:22420695-22420717 GGGGGTGCAGCGGGGCTGAATGG - Intronic
1136354595 16:29735928-29735950 GGTGCTGATGGGGGGCAGAAAGG + Intergenic
1137858166 16:51817720-51817742 AGTGGGACTGCTGGGCTGAATGG + Intergenic
1138649529 16:58451456-58451478 GGTGGTTCTGGTGGGTGGGACGG + Intergenic
1140689491 16:77468055-77468077 GGTGGTGGTGGTGGTGAGAATGG - Intergenic
1140891826 16:79291298-79291320 GGAGGTGCTGGTGGGAGGGACGG + Intergenic
1141050788 16:80761463-80761485 GGTGGTGCTGGTGGTCTTGAAGG + Intronic
1141441183 16:84030695-84030717 AGTGCTGCTGGTGGGTTGGAAGG - Intronic
1141657034 16:85421942-85421964 GGGGGTGCTGTGGGGCTGAACGG - Intergenic
1141793935 16:86256822-86256844 GGTGGTATTGGTGGGCTGAGTGG - Intergenic
1142044146 16:87914470-87914492 GGGGGTGCAGCGGGGCTGAACGG - Intronic
1142270746 16:89088210-89088232 AGTGGTGGTGGTGGGAGGAAGGG - Intergenic
1142283491 16:89161215-89161237 GGAGGTGCTGAAGGGATGAAGGG - Intergenic
1142383429 16:89747016-89747038 GATGGTGCTCCTGGGCTGACCGG + Intronic
1142809253 17:2387528-2387550 GGTGGTGCTGGGGGGTGGCAGGG + Exonic
1142964693 17:3573285-3573307 GGTGGTCCTGGAGGGAAGAAGGG - Intronic
1144608592 17:16689513-16689535 ACTGGTGCTCGCGGGCTGAAGGG + Intergenic
1144677101 17:17168598-17168620 GGAGGTGGTGGTGGGCTGAGTGG + Intronic
1145128366 17:20320428-20320450 ACTGGTGCTCGCGGGCTGAAGGG + Intergenic
1145196247 17:20896786-20896808 ACTGGTGCTCGCGGGCTGAAGGG - Intergenic
1145200993 17:20944588-20944610 AGTGGTGATGGTGGGGTTAACGG + Intergenic
1146557587 17:33839839-33839861 GCTGGCTCTGGTGTGCTGAAAGG - Intronic
1146647779 17:34586630-34586652 GGTGGTGGTGGGGAGCTGAAAGG - Intronic
1146707740 17:35013836-35013858 GGTGATGCTGGGGGGTTGGAGGG + Intronic
1146972940 17:37087115-37087137 GGTGTGACTGGTGGGCTGGAGGG + Exonic
1147265064 17:39229616-39229638 GGTGCTGCCGGGGGGATGAATGG + Intergenic
1147702061 17:42402553-42402575 CTTGGTGCTGATGGCCTGAAGGG - Exonic
1148150468 17:45394047-45394069 GGTGGAGCTTGTGGTCTGATGGG - Exonic
1148380464 17:47193152-47193174 GGTGGGGGTGGTGGGGTGCAAGG - Intergenic
1148768210 17:50051691-50051713 GGTGGTGCTTGTGGGACAAAGGG - Intergenic
1148953668 17:51335937-51335959 GGTGGGGCTGAGGGGGTGAAGGG + Intergenic
1149218277 17:54384661-54384683 GGTGGTGCAGTTGGGGTGAGTGG - Intergenic
1151013761 17:70531103-70531125 GGTGGGGATGGTGGGGTGGAGGG + Intergenic
1151013803 17:70531189-70531211 GGTGGGGATGGTGGGGTGGAGGG + Intergenic
1151374974 17:73681968-73681990 GGTGGTGAGGCTGGGCAGAAGGG + Intergenic
1151425862 17:74030704-74030726 GGGGGTGCTGGGAGGATGAAAGG - Intergenic
1151634619 17:75337245-75337267 GGTGGAGCAGTTGGGTTGAAAGG - Intronic
1151961328 17:77407515-77407537 GGTTGTGCTGGAGGGCTCAGTGG + Intronic
1152334110 17:79690584-79690606 GGTGGGGCCGCTGGGCTGCATGG + Intergenic
1152344624 17:79743436-79743458 GGTGGTGGTGGGGGGCTCAGAGG - Intergenic
1152541812 17:80980350-80980372 GGAGGTGGTGCTGGGCTGGAGGG - Intergenic
1152558902 17:81068099-81068121 GGTGGTGCCAGTTGGCAGAAGGG + Intronic
1154173077 18:12064373-12064395 ACTGGCGCTGGTGGTCTGAAGGG - Intergenic
1155225321 18:23724916-23724938 GGTGGTGCAGGAAGGCTGCAGGG - Intronic
1157280386 18:46343201-46343223 GGGGCTGCTGGTGGGCAGAGAGG - Intronic
1157710759 18:49848244-49848266 GCTGGTGGTGATGGGCTGGAAGG + Intronic
1158461675 18:57651539-57651561 AATGGTGATGGTGGGTTGAAAGG - Intronic
1158997668 18:62939732-62939754 GTTGGTGCTTGTGTGTTGAAGGG + Intronic
1159294744 18:66470422-66470444 GGTGGTGGTGGTGGGCTTCTAGG - Intergenic
1159983399 18:74813464-74813486 GGTGGTGGGTGTGGGGTGAAGGG - Intronic
1160155694 18:76432367-76432389 GGTGGTGCTGGTGCTTTGCACGG - Intronic
1160762821 19:794175-794197 GGTGGGGCTGAGGGGCTGAGAGG + Intergenic
1161124259 19:2546975-2546997 GGTGGTGCTCGGGAGCTGAAGGG + Intronic
1161328156 19:3673175-3673197 GGTGGCGCTGGCGTGCTGGAGGG - Intronic
1161883074 19:6971247-6971269 GGAGGTGCTGGTGTTCTGGATGG + Intergenic
1163136834 19:15317629-15317651 GGTGGTGGTGGTGGTCAGGAAGG + Intronic
1163484190 19:17576673-17576695 GGTGGGGCTGGGGGGGTGCAGGG + Intronic
1163704536 19:18804510-18804532 GCTGGGGCTGGGGGGCAGAACGG + Intergenic
1164714222 19:30379697-30379719 GGTGGTGCAGGGTGGATGAAGGG + Intronic
1165420671 19:35720626-35720648 GGTGGTGGTGGAGGGCAGAGTGG - Exonic
1165579456 19:36849928-36849950 GCTTGTGCTGGTGGGATGAGGGG - Intronic
1165717547 19:38056187-38056209 GGTGGTGCTGGTGCAGAGAAGGG - Intronic
1165732559 19:38155692-38155714 GGGGGAGCTGGTGTGCTGATGGG - Intronic
1165740605 19:38203199-38203221 GATGGTGCTGCTGGGCTGAGGGG + Intronic
1165832738 19:38737285-38737307 GGGGGGGCTGGGGGGCTGCAGGG - Exonic
1165939570 19:39408361-39408383 GGTGGTGGTGGGGAGCTGGAGGG - Exonic
1166046111 19:40232129-40232151 GCTGGTGCTGTGGGGCTGAGGGG - Exonic
1166676708 19:44745589-44745611 GGAGGAGCTGGTGGGGTGGAGGG - Intergenic
1166773350 19:45297824-45297846 GGTGGTGGGGGTGTGCAGAATGG + Exonic
1166822217 19:45587601-45587623 TTTGGTGTTGGTGGGCTGGAGGG - Intronic
1166965394 19:46526836-46526858 GGGGGTGGGGGTGGGCTCAAGGG - Intronic
1167238371 19:48328495-48328517 GATGGGGCTGGTGCTCTGAATGG + Intronic
1167563362 19:50239990-50240012 GGGGGTGCTGGTGGTGGGAAGGG - Intronic
1167669026 19:50839074-50839096 GGTGGGGCTGGGGGGTTTAAGGG + Intergenic
1168361786 19:55746972-55746994 GGTGATGATGGGGGGCGGAAAGG + Intergenic
925305081 2:2842547-2842569 TGTGGCTCTGGTGGGCTGGAGGG + Intergenic
925365000 2:3305349-3305371 GATGGGACTGGAGGGCTGAACGG - Intronic
926219134 2:10923504-10923526 TGGGGTGAGGGTGGGCTGAATGG + Intergenic
926298895 2:11588414-11588436 GGTGGTGCTGGAGGAGTGACAGG + Intronic
926611573 2:14953149-14953171 GATGGAGCTGGAGGGCTGGACGG + Intergenic
927544191 2:23939021-23939043 GGAGGTGGTGGTGGGGGGAACGG + Intronic
928099419 2:28427249-28427271 GGTGCTGCTGGTGGGCGCACAGG + Intergenic
930613559 2:53570140-53570162 GGTGGTGGTGGTGAGTTGACTGG - Intronic
932080981 2:68715067-68715089 GGTGGGGCTTGTGCGCTGGAAGG + Intronic
932420698 2:71599703-71599725 GGAGGTGGCGGTGGGATGAAAGG + Intronic
932893127 2:75613059-75613081 GGAGGTGCTGGTGGGAGGAAGGG - Intergenic
934149850 2:89135796-89135818 GGTGATGCTGGGAGGCTGAGGGG + Intergenic
934217447 2:90046235-90046257 GGTGATGCTGGGAGGCTGAGGGG - Intergenic
935957996 2:108397854-108397876 GGTGGTGGTGGTGGGGAGGAGGG - Intergenic
936667281 2:114610890-114610912 GGGGGTGGTGGTGGCCTGAGGGG - Intronic
936684473 2:114811654-114811676 GGTGATGGTGGTGGGGTGAGGGG - Intronic
938102318 2:128505454-128505476 GGTATTGCTGTTGGTCTGAATGG - Intergenic
938104797 2:128522467-128522489 GGTGGTGCTGCTGGGCCTTAGGG + Intergenic
938262449 2:129905563-129905585 GGAGGTGCTGGTTGCCTGATGGG - Intergenic
938310363 2:130285283-130285305 GCTGGTGCTGATGGTCTGAGGGG + Intergenic
938391816 2:130912590-130912612 GGAGGGGCCGGTGGGGTGAATGG + Intronic
938444571 2:131367086-131367108 GCTGGTGCTGATGGTCTGAGGGG - Intergenic
938542536 2:132296409-132296431 GGTGGTGCTGGAGAATTGAAGGG - Intergenic
940140360 2:150485988-150486010 GGAGGGGCTGGTGTGGTGAAGGG + Intronic
940240876 2:151562036-151562058 GGTGGTGTCAGTGGGCTGATGGG - Intronic
940845619 2:158638633-158638655 GGGGGTGCAGGTGGGGTGAGGGG + Intronic
945434514 2:209803337-209803359 GGAGGTGCTGGTGGTCATAATGG - Intronic
946394773 2:219437726-219437748 GGTGATGCTGGGGGACTGACTGG + Intronic
947791502 2:232871787-232871809 GGTGGTCCGTGTGGGCCGAAGGG + Intronic
948233693 2:236370804-236370826 GGTGGTGGGGGTGGGCTGGTGGG + Intronic
948808646 2:240463651-240463673 GGTGGTGCTGCAGGGTTGAGGGG + Intronic
948992827 2:241563412-241563434 GGTGCTGCTGTTGGGGTGAGTGG + Intronic
949017174 2:241720091-241720113 GATGGTGCAGGTGGGCAGACGGG + Intronic
1168949156 20:1784693-1784715 TGTGGGGCTGGAAGGCTGAAGGG + Intergenic
1169061100 20:2660883-2660905 GGTGGTCTGGGTGGGGTGAATGG - Intronic
1169770207 20:9191740-9191762 GGAGGTGCTGGAGGGGAGAAGGG - Intronic
1170515999 20:17130947-17130969 GGTGATGTTGGTGGGATGGAGGG - Intergenic
1170941881 20:20854722-20854744 GGAGGTGGTGGTGAGCTCAAGGG + Intergenic
1171035577 20:21710077-21710099 GGTGGTGGTGGTGGGCGGGTGGG + Intronic
1171353963 20:24529361-24529383 GGTGGTGGTGGTGGTATGGAAGG + Intronic
1172044563 20:32071260-32071282 TGAGGTGCTGGTGGGGTGGAGGG + Intronic
1172527279 20:35607531-35607553 GGGCGGGCTGGTGGGCAGAAGGG - Intergenic
1172625102 20:36342323-36342345 GGGAGTGCTTGTTGGCTGAATGG + Intronic
1173561839 20:44011630-44011652 GATGGTGCGGCTGGGCTGCAGGG + Intronic
1174116003 20:48226629-48226651 GGTGGTGGTGCTGGGGTCAACGG + Intergenic
1174133471 20:48362337-48362359 GGAGGTGCTGGTGGGGTCACTGG - Intergenic
1174335121 20:49854304-49854326 GGTGGTGGGGGTGGGGTGAGTGG - Intronic
1174553606 20:51378699-51378721 GGTGGTGGAGGTGGGATGGAGGG + Intergenic
1174938025 20:54893571-54893593 GGTGGTGGTGCTAGGCTAAATGG + Intergenic
1175073985 20:56358739-56358761 GGCGGGGCTGGTGGGCGGAGAGG + Intergenic
1175257998 20:57658418-57658440 GGTGCTGCTGGTGAGTTGGATGG - Intronic
1175502617 20:59461134-59461156 GGTGGGGATGCTGGGCTGCAGGG + Intergenic
1175888795 20:62306978-62307000 GGTGGGGCTGGAGGACTGGAGGG + Intronic
1176176651 20:63730137-63730159 GATGGTGTGGGTGTGCTGAAGGG + Intronic
1178041450 21:28644432-28644454 GGTGGTGGTGGTGGGATGGTGGG - Intergenic
1178823821 21:35998654-35998676 TGTGGTTGTGGGGGGCTGAACGG - Intronic
1179141537 21:38730194-38730216 GGTGGAGTTGGTGGGCGGAGAGG - Intergenic
1179662161 21:42883429-42883451 GGTGGTTGTAGTGGGTTGAAAGG + Intronic
1180161795 21:46001538-46001560 GGTGGAGCTGGAGGCCTGGACGG - Intronic
1181622461 22:24100451-24100473 GGATGTGCTGGTGGCCTCAAGGG + Intronic
1181985804 22:26799189-26799211 GGAGGAGCTGGGGGGCTGTAAGG - Intergenic
1183461731 22:37955049-37955071 GATGGAGCTGTTGGGGTGAAAGG + Intronic
1183466880 22:37984427-37984449 GGTGACGCTGGTGGGCTGGGAGG + Exonic
1183909610 22:41068601-41068623 GGTGGTGGTGGGGGACAGAAAGG - Intergenic
1183927943 22:41219207-41219229 GGTGGAGGTGGTGGGATGCAGGG - Intronic
1184205311 22:42998769-42998791 GGGGGACATGGTGGGCTGAAAGG - Intronic
1184400440 22:44270769-44270791 AGTGGTGCTGGTGGTCTCACTGG - Intronic
1185228779 22:49668351-49668373 GCAGGTGCTGGGGGGCTGCATGG - Intergenic
949509600 3:4756761-4756783 GTTGGTTCTGGTAGGTTGAATGG - Intronic
949970290 3:9397825-9397847 GGTGGGGGTGGGGGGCAGAAAGG - Exonic
950174013 3:10859339-10859361 AGTGGTGCTGGTAGGCGAAATGG + Intronic
950202861 3:11057198-11057220 GGGGGTGGTGGTGGCCAGAAGGG - Intergenic
950697648 3:14715580-14715602 GGTGGTCCAGGTTGGCTGAAGGG + Intronic
950914420 3:16629259-16629281 GGTGATGATGGTGGCTTGAAGGG + Intronic
952307397 3:32158368-32158390 GGTGGTGGAGGTGGGCTGGAAGG + Intronic
952423644 3:33153150-33153172 GGTGGAGCTGGTGAGCTCATAGG + Exonic
953645967 3:44755337-44755359 GGTGGAACTGTTGGGTTGAAAGG + Intronic
954875602 3:53801116-53801138 GGTGGTATTGGTCTGCTGAAGGG - Exonic
955684949 3:61540128-61540150 GGTGGTTCTGGTGTGCAGCAAGG + Intergenic
956057410 3:65315041-65315063 GACAGTGCTGCTGGGCTGAAAGG - Intergenic
956952627 3:74299697-74299719 GGTGGTGATGGTGGGATTAGTGG - Intronic
957198787 3:77105405-77105427 GGTGGTGATGGTGGGTGGTAGGG + Intronic
957215744 3:77317706-77317728 GGTGCTGCTGGGGGGCTGCTAGG + Intronic
957891544 3:86365352-86365374 GGTGGTGGGGGTGGGGTGGAAGG - Intergenic
959045116 3:101465169-101465191 GGTGCTGATGGTGGGCAGAGTGG - Intronic
959160020 3:102711907-102711929 GGTGGTGGTGGTGGGCAGAAGGG + Intergenic
959268424 3:104172509-104172531 GGTGGAGTGGGTAGGCTGAATGG - Intergenic
959663646 3:108897262-108897284 GGTGGAGCGGGTGGGAGGAAGGG + Intergenic
959899946 3:111649714-111649736 GGAGGTGGTGGTGGCTTGAAAGG - Exonic
960486843 3:118263198-118263220 GGTGGTGCTGGGAAGCTGCAGGG - Intergenic
960712730 3:120547035-120547057 GGTGGAGTTGGTGGACTGAGTGG + Intergenic
961534805 3:127563834-127563856 GGTGGTGCTGGTGGTGTTGATGG - Intergenic
961566214 3:127765020-127765042 GGTGGTCCTTGTTGTCTGAAAGG - Intronic
963041739 3:141075199-141075221 GGTGATGCTGATGGGTTGGAGGG + Intronic
963678239 3:148341412-148341434 GGTGGTGATGGTGTGCTAAAGGG + Intergenic
965276942 3:166696037-166696059 AGTGGTGCTGAAGGGGTGAATGG - Intergenic
967180427 3:186898404-186898426 GGTGGTCCTGCTGGGGTGTAAGG - Intergenic
967221210 3:187249536-187249558 GGGGGTGGTGGTGAGGTGAAGGG + Intronic
967387678 3:188927352-188927374 GGGGGTTCTTGTGGGCTGAGTGG - Intergenic
967816634 3:193804687-193804709 ATTGGTGCAGGTGGGCTGCAGGG - Intergenic
968428419 4:537936-537958 GGTGGAGCTGCTGGGCTGACAGG + Intronic
968534045 4:1112880-1112902 GGAGGTGGTGGGGGGCTGCAGGG - Intronic
968752665 4:2398272-2398294 GGTGGTCATGGTGGGCTGCTTGG + Intronic
968949605 4:3683722-3683744 GCTGGGGCTGTTGGGGTGAACGG - Intergenic
969265818 4:6063526-6063548 GCTGAGGCTGGTGGGCTGACGGG + Intronic
969280896 4:6170253-6170275 GGTGGTGGTGGTGGTGAGAAGGG - Intronic
969280916 4:6170340-6170362 GGTGGTGGTGGTGGTGAGAAGGG - Intronic
969281082 4:6171052-6171074 GGTGGTGATGGTGGTCAGCATGG - Intronic
969395428 4:6917563-6917585 GGTGGTGCAGTAGGGCTGAGTGG + Intronic
969506530 4:7591475-7591497 GGTGGTGCTGGCAGGCTGGTGGG + Intronic
970170098 4:13280827-13280849 GGTGGTGCTGGAGGGTGGGAGGG - Intergenic
971635043 4:29047428-29047450 GGTGGGGCGGGGGGCCTGAAGGG - Intergenic
973318950 4:48790332-48790354 GTTGGTGCTAGGTGGCTGAAAGG - Intergenic
973849761 4:54949309-54949331 GGTGTCTGTGGTGGGCTGAATGG - Intergenic
975324183 4:73041450-73041472 GGTGGAAGTGGTGGGCTGAATGG + Intergenic
978110946 4:104963610-104963632 GGTGGTGGTGATGGGCTGGGTGG + Intergenic
978291923 4:107152067-107152089 GGTGGTGGTGGTGGTCAGTAAGG + Intronic
980076446 4:128298796-128298818 GGTGGTGGTGGTGAGAGGAAAGG - Intergenic
980483594 4:133423677-133423699 GGAGGTGGTGGTAGGCTGCATGG + Intergenic
980808000 4:137838114-137838136 AGTGGTAGTGGTGGGCTGAGTGG - Intergenic
981552866 4:145959445-145959467 GGTGGTGGTGGTGGGTGGATGGG + Intergenic
982662393 4:158222673-158222695 GATGGTGATGGTGGGAGGAATGG - Intronic
983593580 4:169441492-169441514 GGTGGTGGTGGTAGGCAGGAGGG - Intronic
985188209 4:187341515-187341537 GGTGGGACTGCTGGGTTGAATGG - Intergenic
985607081 5:863539-863561 GGAGGTGCTGGTGGGCGCACAGG + Intronic
985616167 5:923185-923207 GGGGGTGCTGGGGGGCTCTAAGG + Intergenic
985783733 5:1883709-1883731 GGTGGGGGCGGTGGGCTGAGCGG - Intronic
985970914 5:3377680-3377702 GGAGGTGCTGGGAGGCTGATGGG + Intergenic
986308807 5:6536076-6536098 GGTGGTGTTTGTGGGTAGAAGGG - Intergenic
986495565 5:8338484-8338506 GGTGGTGGTGGTGGGAGGAGGGG - Intergenic
987401167 5:17478441-17478463 GGTGCTTGTAGTGGGCTGAATGG - Intergenic
991047185 5:62235015-62235037 GTTGGGACTGGGGGGCTGAAAGG + Intergenic
992939726 5:81750712-81750734 GGTGGTGCTGGTGGCGAGGATGG - Intronic
994184543 5:96803648-96803670 GATGGTGCTGGTGGGCTGACTGG + Exonic
994353084 5:98769071-98769093 GGTGGCGCTGGCGGCGTGAAAGG + Intronic
994688109 5:102982258-102982280 AGTGGTGGTAGTGGGCTGGAAGG - Intronic
994871945 5:105362543-105362565 GGTGGTTGTGGTGGGTTGGATGG - Intergenic
995188736 5:109298486-109298508 GGTGGTGGTGGTGGGCGGGGGGG - Intergenic
995623376 5:114052440-114052462 GGTGATGCTGGTGACCTGTATGG + Intergenic
996895389 5:128475066-128475088 GGTGGTGGTAGTGGTCTGTAAGG + Intronic
997022629 5:130019418-130019440 GGTGGTGGTGGTGGGGTGTTGGG - Intronic
997085536 5:130793428-130793450 GGTGGGATTGGTGGGATGAATGG - Intergenic
997266235 5:132496819-132496841 GGTGGTGCTGAGCGGCTGGACGG + Intergenic
998033868 5:138896612-138896634 GCTGGTATTGGTGGGCTGGATGG + Intronic
998165197 5:139838738-139838760 GGTGGTGCAGGAGGGCAGCAGGG - Exonic
998912013 5:146970053-146970075 GATGGTGCTGGTGGAGTAAATGG - Intronic
999231947 5:150066850-150066872 GGTGGGGTTGGGGGTCTGAAGGG - Intronic
999328587 5:150658212-150658234 GGTGGTGGTGGTGGGCTAGTTGG + Intronic
1001573273 5:172744706-172744728 GGTGGGGCTGGTGGCCAGAAAGG - Intergenic
1001726146 5:173902495-173902517 GGTGGTGGTGGTGGGTAGCATGG + Intronic
1001979284 5:176027665-176027687 AGTGGGGCTGCTGGACTGAATGG - Intronic
1002200856 5:177527259-177527281 GGTGGGGCAGGTGGGCAGGAAGG + Intronic
1002238132 5:177816096-177816118 AGTGGGGCTGCTGGACTGAATGG + Intergenic
1002380358 5:178823725-178823747 AGTGGGGCTGCTGGACTGAATGG - Intergenic
1002671224 5:180869170-180869192 GGTGGCGCTGTTGAGCTGGAAGG + Intergenic
1003081805 6:3027376-3027398 GGTGGTGGTTGTGGGGTGAGGGG - Intergenic
1006002077 6:30972887-30972909 GGTGTTGCTGGTTGGCTCACGGG - Intergenic
1006009743 6:31032388-31032410 GGTGCTGCTGGTTGGCTCACGGG - Exonic
1006180475 6:32150793-32150815 GGTGGTGATGGTGTGAGGAAGGG + Exonic
1006589034 6:35140992-35141014 GGGGGTGCTGAGGGGCAGAAAGG + Intronic
1007092660 6:39193791-39193813 GTGGGTGCTGGTGGGCTCAGGGG + Intronic
1007419688 6:41712163-41712185 GATGGTGCTGGTGGCCAGACAGG - Intronic
1007742554 6:44021751-44021773 GGTGGTGCTGGGGGAGGGAAGGG - Intergenic
1007743125 6:44024970-44024992 GGTGGTGCTGGGGGAGGGAAGGG - Intergenic
1008029729 6:46680832-46680854 GGTGGTGGTGGTGGGAAGAAAGG - Intergenic
1008618299 6:53247018-53247040 GCTGGAGCTGGTGGGCTGGCTGG + Intergenic
1012545819 6:100418482-100418504 TGTGGTGAGGGTGGGCAGAAAGG - Intronic
1013606387 6:111752863-111752885 GGTGGTGAGGGTGGGATGGAGGG + Intronic
1014443537 6:121500338-121500360 GCTGGAGCTCCTGGGCTGAAGGG + Intergenic
1014852803 6:126362088-126362110 GGAGGGGCTGGTGGGCAGGAGGG + Intergenic
1015884105 6:137898612-137898634 GGTGGTGCAGGTGGTGGGAATGG - Intergenic
1016210961 6:141532436-141532458 AGTGGTCCTGCTGGGCTGAGTGG + Intergenic
1018871858 6:167790037-167790059 GGTGGTGATGGTGGCATGCAAGG - Intronic
1019344516 7:522755-522777 GGAGGTGCTGGTGGGAAGCAAGG + Intergenic
1019462034 7:1164996-1165018 GGTTGTGATGGTGAACTGAAGGG - Intergenic
1019570253 7:1708091-1708113 TGGGGTGCTGGTGGGGTGCAGGG - Intronic
1019572776 7:1720713-1720735 GGGGGTGCTGGGGGGAGGAAGGG - Intronic
1019810880 7:3164357-3164379 GGGGGAGCAGGTGAGCTGAAGGG - Intronic
1020085632 7:5308840-5308862 GGTGGTGGTGGTGGGCGGGTTGG - Intronic
1020257054 7:6508250-6508272 GGCGGTGGTGGGGGGCTGAGCGG + Exonic
1020998246 7:15292375-15292397 GTCGGTTCTAGTGGGCTGAATGG + Intronic
1022339695 7:29456612-29456634 GGTGGTGGTGGTGGGGGGGAGGG - Intronic
1022900699 7:34807885-34807907 GGTGGTGGTGGTGGGGGGTAGGG - Intronic
1023143915 7:37130197-37130219 GGTGGTGGTGGTGGGGTGGGGGG - Intronic
1023235628 7:38082879-38082901 GGTGGTGGTAATGGGCTGAAGGG + Intergenic
1023473648 7:40552748-40552770 GGTGGGGATGGGGGGCTGGAAGG - Intronic
1023931789 7:44710744-44710766 TGTGGTGTGGGTGAGCTGAAGGG + Intergenic
1024228249 7:47344793-47344815 GGGGGCTCAGGTGGGCTGAACGG + Exonic
1027338742 7:77182862-77182884 GGTGGTGATGATAGGGTGAAGGG - Intronic
1027569508 7:79847023-79847045 GGGGGTACTGGTGGGCCAAAAGG - Intergenic
1029171245 7:98630462-98630484 GGTGGTGGTGGTGGGCGGTGGGG - Intergenic
1029524712 7:101087750-101087772 GGTGGACCTGGTGGGCTACAGGG + Exonic
1029552267 7:101243681-101243703 GGTGGTGGTGTTGGGGGGAAGGG + Intronic
1029982372 7:104890896-104890918 GGCGCTGCTGGTGGGCTTCATGG - Intronic
1030927571 7:115477291-115477313 GAAGGTGCTGGGGGGCAGAACGG + Intergenic
1032011169 7:128349172-128349194 GGTGGTGCCGGTGCGGTGGAGGG - Intergenic
1032268979 7:130386881-130386903 GGTGGGGCAGGTGGGTTGAAGGG + Intronic
1032561245 7:132895373-132895395 GGTAGTGCTGCTGGGCTGTACGG - Intronic
1033075641 7:138247715-138247737 GCTGGTGCTGACGGGCTGAGAGG + Intergenic
1034069692 7:148172241-148172263 GGTGGTGCTGGGGGCCAGCAGGG + Exonic
1034473495 7:151269310-151269332 GGAGGTGCTGGTGGGTCGGAAGG - Intronic
1035034613 7:155886669-155886691 GGTGGGGCTGGCGGGGTGAAGGG + Intergenic
1035372582 7:158388738-158388760 GGTGGGGCTGGTGGCCAGAAAGG - Intronic
1037313702 8:17581519-17581541 GGTGGTGGTGGTGGGAGGTAGGG + Intronic
1037427979 8:18777789-18777811 AGTGGTGGTGGTGGGATTAAAGG - Intronic
1037714867 8:21388728-21388750 CTTGGTGCTGGAGAGCTGAAAGG - Intergenic
1037949818 8:23011638-23011660 AGTGGTGCTCGTGGGGTGAAGGG + Intronic
1038418459 8:27415252-27415274 GGTGGTGGTGGTGGGTGGATGGG + Intronic
1038521707 8:28238687-28238709 GGTGGTGGGGGTGCCCTGAAGGG - Intergenic
1039458973 8:37727559-37727581 GGTGGTGTTGGAGGAATGAAGGG - Intergenic
1039467768 8:37796629-37796651 GGTGGTGGTGGTCGGCTCAGAGG + Intronic
1039759945 8:40563851-40563873 GGTGATGCTGGTAGGCTGTGAGG + Intronic
1040015611 8:42696670-42696692 GGTGGGCCTGGTGGGGTCAAGGG + Intergenic
1040300081 8:46183458-46183480 GGTGGCGTTGGTGGGCCGCAGGG - Intergenic
1040300862 8:46187345-46187367 GGTGGTGTTGGAGGGCTGCAGGG - Intergenic
1040301118 8:46188482-46188504 GGTGGTGTGGGTGGGCCGCAGGG - Intergenic
1040307846 8:46221456-46221478 GGTGGCGTAGGTGGGCTGTAAGG + Intergenic
1040311795 8:46240614-46240636 GGTGGCGTGGGTGGGCTGCAGGG + Intergenic
1040312508 8:46244030-46244052 GGTGGTGTGAGTGGGCTGCAGGG + Intergenic
1040313636 8:46249602-46249624 GGTGGTGTGGGTGGGCTGCAGGG + Intergenic
1040324337 8:46334110-46334132 GGTGGCGTTGGGGGGCTGCAGGG + Intergenic
1040334366 8:46408583-46408605 GGTGGCGTGGGTGGGCAGAAGGG + Intergenic
1040336807 8:46420236-46420258 GGTGGTGTGGGTGGGCCGCAGGG + Intergenic
1040337650 8:46424196-46424218 TGTGGCGTTGGTGGGCTGCAGGG + Intergenic
1040342461 8:46447850-46447872 GGTGGTGTGAGTGGGCAGAAGGG - Intergenic
1040766039 8:50912630-50912652 GATGGTGTTGGTGGGCTGAATGG - Intergenic
1040933178 8:52756472-52756494 GGTGGTGCATGTGGGCATAAAGG - Intergenic
1041701113 8:60790090-60790112 GATGCTGCTGGAGGTCTGAAGGG - Intronic
1042175579 8:66034570-66034592 GGTGGCAGTGGTGGGCAGAAAGG + Intronic
1042851959 8:73225789-73225811 GGTGGTGGTGGAGGGCTGGGGGG - Intergenic
1043517190 8:81005734-81005756 GGAGGGGCAGGTGTGCTGAACGG - Intronic
1044251461 8:90007550-90007572 GGTGGTGGGGGTGGGGTTAATGG + Intronic
1045227320 8:100261686-100261708 GGAAGTGTTGGTGGGCTGACTGG - Exonic
1045555341 8:103209541-103209563 GGTGGGGCTCATGGGGTGAAAGG - Intronic
1046265459 8:111823731-111823753 AGTGCAGTTGGTGGGCTGAAGGG + Intergenic
1046454537 8:114440900-114440922 GGAGGGGCTGGTGGGCAGAAGGG - Intergenic
1047400038 8:124538688-124538710 GGAGGTGCACGTGGGATGAATGG + Intronic
1047750528 8:127877032-127877054 GGTGGTGCTTATGGGATGTATGG + Intergenic
1047823572 8:128548934-128548956 AGTGGTGGTTGTGGGATGAATGG + Intergenic
1048031808 8:130640207-130640229 GGTGGGGCTGGTGGGCAGGAGGG + Intergenic
1048381655 8:133870660-133870682 AGTGGTGCTGGCGAGCTGAAAGG - Intergenic
1048442329 8:134469175-134469197 GGTGGTGTTGGGGGGCTGATGGG + Intergenic
1049051341 8:140199095-140199117 GGTGGAGCTGGGGAGCTGTATGG + Intronic
1049585203 8:143429800-143429822 GGTGGTGGTGGTGGGCGGCGTGG + Exonic
1049812754 8:144582794-144582816 GCTGGTGGTGGAGGGCTGCAGGG + Intronic
1052402040 9:28012582-28012604 GGAGGAGCTGGTGGCTTGAATGG - Intronic
1052748760 9:32467446-32467468 GGTGGTGCTGGTGGGCTGAAGGG - Intronic
1052840427 9:33288322-33288344 GGTGGTGTTGGGGGGCTGGGGGG + Intergenic
1053289639 9:36871454-36871476 GGTGGGCCTGGAGGGCTTAAAGG - Intronic
1053429680 9:38033852-38033874 GGTGGTGCTGGGGGGGTGTCAGG - Intronic
1054777310 9:69134463-69134485 AGTGGTGTTGGAGGCCTGAAGGG + Intronic
1055540810 9:77303322-77303344 GGTGGTGATGGTGATCTGGAAGG + Intronic
1058127280 9:101209483-101209505 GGAGGTGCTGATGGACTGAAGGG - Intronic
1058547793 9:106079535-106079557 TCTGGTGGTGGTGGGCTGGAGGG + Intergenic
1059501334 9:114756682-114756704 GGTGGTGCTGGTTGTGGGAAAGG + Intergenic
1059768078 9:117402787-117402809 GGTGGTGGTGGTGTGATGGAGGG + Intronic
1060284435 9:122236440-122236462 AGTGGTGGGGGTGGGCAGAAGGG + Intergenic
1060774944 9:126366149-126366171 GGAGGAGCTGGTGAGATGAAGGG - Intronic
1061420293 9:130469893-130469915 AGTGGGGCTGAGGGGCTGAAGGG + Intronic
1062107140 9:134761937-134761959 GGAGGTCCTGGTGGGCCGGAAGG - Exonic
1062558628 9:137129277-137129299 GGCGGTGGTGGTGGGAGGAAGGG - Intergenic
1185854750 X:3523770-3523792 GGTGGTGCAGTGGGGATGAAGGG - Intergenic
1186963425 X:14761757-14761779 GATGATACTTGTGGGCTGAATGG - Intergenic
1187603734 X:20861346-20861368 GCTGGTGCTGCCGGGATGAAGGG - Intergenic
1191675093 X:63785058-63785080 GGTGGGGCTGGGGGACTGAGAGG + Intronic
1192194892 X:69021510-69021532 GGGGGTGGTGGTGGGATGAGGGG + Intergenic
1192451012 X:71244940-71244962 GGTGGGGCAGGAGGGCTGCAGGG - Intronic
1193816228 X:86107616-86107638 GCTGGTGCTGCTGGGATGCAGGG + Intergenic
1195404949 X:104502713-104502735 GGGGGTGGTGGTAGGCAGAAAGG - Intergenic
1196485070 X:116196876-116196898 AGTTTTGTTGGTGGGCTGAAAGG + Intergenic
1197841776 X:130755861-130755883 GGTAGTGGTGGTGGGGTGGAGGG - Intronic
1197893604 X:131288742-131288764 GGGGGTGGGGGTGGGGTGAAAGG - Intronic
1198394476 X:136208168-136208190 GGTGGTGCGGGTGGCCCGTATGG + Intronic
1199541044 X:148958412-148958434 GGTGGGGCTGGTGAGATGCAAGG - Exonic
1199682565 X:150237081-150237103 AGTGGTGCTGGTGGTCTCACCGG - Intergenic
1201077951 Y:10200674-10200696 GTTGGTGCTGGTGGGGTGGATGG + Intergenic
1201355677 Y:13094624-13094646 GGTGGTGCTGGTGGCTTCTAAGG - Intergenic