ID: 1052748761

View in Genome Browser
Species Human (GRCh38)
Location 9:32467447-32467469
Sequence TGGTGGTGCTGGTGGGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 910
Summary {0: 1, 1: 0, 2: 7, 3: 122, 4: 780}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052748761_1052748769 21 Left 1052748761 9:32467447-32467469 CCTTCAGCCCACCAGCACCACCA 0: 1
1: 0
2: 7
3: 122
4: 780
Right 1052748769 9:32467491-32467513 GGCAAAGCTTCAATCCAAGTTGG No data
1052748761_1052748768 0 Left 1052748761 9:32467447-32467469 CCTTCAGCCCACCAGCACCACCA 0: 1
1: 0
2: 7
3: 122
4: 780
Right 1052748768 9:32467470-32467492 TGAAAGGTTTACATGTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052748761 Original CRISPR TGGTGGTGCTGGTGGGCTGA AGG (reversed) Intronic
900008139 1:79217-79239 TGGTGGCTGTGGTGTGCTGAAGG - Intergenic
900143802 1:1149564-1149586 TGGGTTTGCTGGAGGGCTGAGGG + Intergenic
900336523 1:2166728-2166750 GGGTGGGGGTGGGGGGCTGAAGG - Intronic
900459927 1:2798158-2798180 TGGGGGTACTGGGGAGCTGAGGG - Intronic
900550619 1:3252609-3252631 GGGTGGGGCTGGTGGGCAGCAGG + Intronic
900653979 1:3746005-3746027 TGGTGGTGCTGATGGCAGGAGGG + Intergenic
900896611 1:5487223-5487245 TGGTGGTGCAGGCAGGGTGAGGG - Intergenic
900942718 1:5811408-5811430 TGCTGGTGCTGATGGGCGGGGGG - Intergenic
901218529 1:7568621-7568643 TGGTGGTGATGGTGATGTGATGG - Intronic
901218548 1:7568769-7568791 TGGTGGTGATGGTGATGTGATGG - Intronic
901353084 1:8616007-8616029 TGTTGGTGATGGTGGGGAGAAGG - Intronic
901700623 1:11043277-11043299 AGGGGGTGCAGCTGGGCTGAGGG + Intronic
902378113 1:16039744-16039766 TGGTGGTGCTGGAGGGATGTCGG - Intergenic
902383202 1:16062240-16062262 TGGTGGTGCTGGAGGGATGTCGG - Intronic
902434638 1:16390315-16390337 TGCTGGTGCTGATGGGCTGAGGG + Intronic
902513022 1:16976417-16976439 GGGTGGTGCTGGTGGGCTGGAGG - Intronic
902681877 1:18049448-18049470 TGGTGATGCTGCTGGGCTGGTGG + Intergenic
902757804 1:18560639-18560661 TGGGGGTGGTGGGGGGCGGATGG - Intergenic
902796098 1:18801174-18801196 TGGTGGTGGTGGTGGTTTGAGGG - Intergenic
902834429 1:19037544-19037566 TGGTGGTGCTGGTGAGAGAATGG + Intergenic
903025773 1:20429078-20429100 TGGTGGTGGGGGAGGGCTGATGG - Intergenic
903283633 1:22263977-22263999 GGGTGGTGGTGGTGGGGTGGGGG + Intergenic
904044248 1:27600707-27600729 TGGTTGTGCTGGAGGCTTGAGGG - Intronic
904354043 1:29927002-29927024 TGGTGCAGGTGGTGGGCTGGGGG - Intergenic
904382395 1:30120123-30120145 TGGTGGGGCTGACTGGCTGATGG - Intergenic
904441507 1:30534831-30534853 TGGTGGGGCTGACTGGCTGATGG - Intergenic
905695505 1:39970565-39970587 TGGTGGGGCTGGAGGCCTGTGGG + Intergenic
905786012 1:40758222-40758244 TCGTGGAGCTGGTGGTCTGCTGG - Exonic
905885674 1:41490627-41490649 TGGTGGTGATGGTGGGATAGAGG - Intergenic
906152295 1:43594583-43594605 TGGTGGCGCAGGTGAGGTGATGG + Intronic
906257140 1:44359083-44359105 TGGTGGTCATGGTGGGAAGAGGG - Intergenic
906700262 1:47852518-47852540 TGGTGGCCCTGGTGGGCTGCAGG - Intronic
907417882 1:54326963-54326985 TGGTGGTGGTGGTGGGTGGGGGG + Intronic
908920579 1:69186545-69186567 TGCTGGGGCTGGTGGTCTGGGGG - Intergenic
909665944 1:78133554-78133576 TGGTGGTGCTGGTGGCTAGGAGG + Intronic
910743478 1:90547672-90547694 TGGTTGTGTTTGTGGGGTGATGG - Intergenic
911008557 1:93253736-93253758 TGGTTGTGCTTGTAGGCTCAAGG + Intronic
911121718 1:94303029-94303051 TGTTGGGGCTGGTGGTCTGGGGG - Intergenic
912637395 1:111310278-111310300 TGGTGATGCTGGTGGTGGGAGGG + Intronic
913069124 1:115283927-115283949 TGGTGGTGTTCCTGGGATGAGGG + Intergenic
913071562 1:115303589-115303611 TGGTGGTGGTGGTAGGATGTTGG - Intronic
914349122 1:146824543-146824565 TGGTGCTCCTGGCGTGCTGAAGG + Intergenic
915441854 1:155950537-155950559 TGGAGGTTCTGCTTGGCTGAAGG + Intronic
917609186 1:176669000-176669022 TAGTGGAACTGGTGGGTTGAGGG + Intronic
917620709 1:176793066-176793088 TGGTGGTGGTGGTGGGTGGCGGG - Intronic
918834591 1:189445320-189445342 TGGTGGTGGTGGTGAGGGGAGGG - Intergenic
919115478 1:193275870-193275892 TGGTGGAGGTGGTGGGGGGAGGG + Intergenic
919738598 1:200969295-200969317 TGGTGGTGGTGGTGGGTGGGTGG - Intergenic
920173997 1:204088918-204088940 GGGAGATGCTGGTGGGTTGAGGG + Intronic
920716144 1:208342204-208342226 TGGTGGTGGTGGTGGGGGGATGG + Intergenic
920730411 1:208478282-208478304 TGGTGGTATTGGTGGGCTCAAGG + Intergenic
920795756 1:209134538-209134560 TGGTGATACTGGTGGGCTGGGGG + Intergenic
921618058 1:217295482-217295504 TGGTGGTGGTGGTGGGGTGGGGG - Intergenic
921948405 1:220904908-220904930 TGGTAGTGCTGGTGAGCCCAAGG + Intergenic
922349993 1:224727522-224727544 TGGGGCTGCTGATGGGCTGTGGG - Intronic
922764165 1:228149015-228149037 TGGTGGTTAGGGTGGGCTGCCGG - Intergenic
923480550 1:234379288-234379310 TGGTGGGACTGGTTGGCTGTTGG + Intronic
924385206 1:243493217-243493239 TGGTGGTGGGGGTGGGGGGAGGG + Intronic
924545003 1:245018530-245018552 TGGTGGTGGTGGTAGGGTTAGGG + Intronic
924758491 1:246963488-246963510 TGGTGGTGATGGTGGTGGGAGGG + Intronic
1062860792 10:807650-807672 TGGTGGAGCTGGAGGGCCGCAGG - Exonic
1063030860 10:2232523-2232545 TGGTCGTGCGGGTAGGATGAGGG + Intergenic
1063690840 10:8285422-8285444 CGGGGGTGGTGGTGGGCTGGGGG + Intergenic
1064035209 10:11908841-11908863 TGGAGGAGCAGGTGGGGTGAGGG - Intergenic
1066467668 10:35667637-35667659 TGGTAGTGATGGTGGTGTGATGG - Intergenic
1067084518 10:43230734-43230756 TGGGGGTGGAGGTGGGGTGAGGG - Intronic
1067527545 10:47047576-47047598 TGGTGGTGCCAGTGGGCACAGGG + Intergenic
1069552999 10:69377358-69377380 GGGTGGGGGTGATGGGCTGATGG - Intronic
1069623528 10:69852676-69852698 TGGTTGGGATGGTGGGCTGGGGG + Intronic
1072169054 10:92842700-92842722 TGGTGGAGTTGGTGGGGTGGGGG + Intronic
1073433032 10:103499214-103499236 TGAGGCTGCTGGGGGGCTGAAGG + Intronic
1075533870 10:123254364-123254386 TGGTGGTGGTGGTGTGATGATGG - Intergenic
1075533884 10:123254457-123254479 TGGTGGTGGTGGTGTGATGATGG - Intergenic
1075533896 10:123254527-123254549 TGGTGGTGGTGGTGTGATGGTGG - Intergenic
1075533905 10:123254588-123254610 TGGTGGTGGTGGTGTGATGATGG - Intergenic
1075533917 10:123254664-123254686 TGGTGGTGGTGGTGTGATGGTGG - Intergenic
1075533918 10:123254667-123254689 TGGTGGTGGTGGTGGTGTGATGG - Intergenic
1075533939 10:123254787-123254809 TGGTGGTGGTGGTGTGATGGTGG - Intergenic
1075533950 10:123254831-123254853 TGGCGGTGGTGGTGGTGTGATGG - Intergenic
1075533961 10:123254901-123254923 TGGTGGTGGTGGTGTGATGGTGG - Intergenic
1075533962 10:123254904-123254926 TAGTGGTGGTGGTGGTGTGATGG - Intergenic
1075533970 10:123254965-123254987 TGGTGGTGGTGGTGTGATGATGG - Intergenic
1075533976 10:123254997-123255019 TGGTGGTGGTGGTGTGATGATGG - Intergenic
1075533979 10:123255014-123255036 TGGTGGTGGTGGTGTGATGGTGG - Intergenic
1075533980 10:123255017-123255039 TGATGGTGGTGGTGGTGTGATGG - Intergenic
1075533985 10:123255049-123255071 TGGTGGTGGTGGTGTGATGATGG - Intergenic
1075533992 10:123255084-123255106 TGGTGGTGGTGGTGTGATGATGG - Intergenic
1075533998 10:123255116-123255138 TGGTGGTGGTGGTGTGATGATGG - Intergenic
1075534005 10:123255151-123255173 TGATGGTGGTGGTGTGATGATGG - Intergenic
1075534009 10:123255174-123255196 TGGTGGTGGTGGTGTGATGATGG - Intergenic
1075534014 10:123255200-123255222 TGATGGTGGTGGTGTGATGATGG - Intergenic
1075534019 10:123255232-123255254 TGGTGGTGGTGGTGTGATGATGG - Intergenic
1075534025 10:123255261-123255283 TGATGGTGGTGGTGTGATGATGG - Intergenic
1075534028 10:123255278-123255300 TGGTGGTGGTGGTGTGATGATGG - Intergenic
1075534034 10:123255314-123255336 TGGTGGTGGTGGTGTGTTGATGG - Intergenic
1075534040 10:123255350-123255372 TGGTGGTGGCGGTGTGATGATGG - Intergenic
1075534046 10:123255385-123255407 TGGTGGTGGTGGTGTGATGATGG - Intergenic
1075534052 10:123255420-123255442 TGGTGGTGGTGGTGTGATGATGG - Intergenic
1075534059 10:123255455-123255477 TGGTGGTGGTAGTGTGATGATGG - Intergenic
1075534068 10:123255519-123255541 TGGTGGTGGTGGTGTGATGATGG - Intergenic
1075534074 10:123255554-123255576 TGGTGGTGGTGGCGTGATGATGG - Intergenic
1075534081 10:123255589-123255611 TGGTGGTGGTGGTGTGATGGTGG - Intergenic
1075534082 10:123255592-123255614 TGGTGGTGGTGGTGGTGTGATGG - Intergenic
1075534088 10:123255618-123255640 TGGTGGTGGTGGTGTGATGATGG - Intergenic
1075534094 10:123255647-123255669 TGGTGGTGGTGGTGTGATGATGG - Intergenic
1075534109 10:123255714-123255736 TGGTGGTGGTGGTGTGATGATGG - Intergenic
1075534126 10:123255798-123255820 TGGTGGTGGTGGTGTACTGATGG - Intergenic
1075534132 10:123255830-123255852 TGGTGGTGGTGATGTGATGATGG - Intergenic
1075719547 10:124576706-124576728 CGGGGGTACTGGGGGGCTGAGGG + Intronic
1075804333 10:125174628-125174650 TGGTGGGGATGGTGGGAGGAGGG - Intergenic
1075814802 10:125256693-125256715 GGGTGGGGATGGAGGGCTGATGG + Intergenic
1075966448 10:126615925-126615947 TGAAGGTGATGGTGGCCTGATGG - Intronic
1076843637 10:133058440-133058462 TGGTGGTGCCTGTGGGTTGGTGG + Intergenic
1076949518 10:133670155-133670177 TGGTGGTGGTGGTGGGGGGGGGG - Intronic
1076950502 10:133673454-133673476 TGGTGGTGGTGGTGGGGGGGGGG - Intergenic
1076953465 10:133683373-133683395 TGGTGGTGGTGGTGGGGGGGGGG - Intergenic
1076958400 10:133752953-133752975 TGGTGGTGGTGGTGGGGGGGGGG - Intergenic
1076960373 10:133759562-133759584 TGGTGGTGGTGGTGGGGGGGGGG - Intergenic
1077156497 11:1094464-1094486 TGGTCGTGCTGGTTGGTGGAGGG - Intergenic
1077326678 11:1967005-1967027 AGGAGGTGCTGGGGGGCTGCAGG + Intronic
1078081776 11:8209375-8209397 AGGAGGTGCTGGTGTCCTGATGG - Intergenic
1078559065 11:12354988-12355010 TGGTGCTGCTGGTGGGAGGCAGG - Intronic
1078595086 11:12679131-12679153 TGGTGGTGGTGGTGGGGAGTAGG + Intronic
1078933650 11:15933768-15933790 TGGTGGTGGTGGTGGGGTGGTGG - Intergenic
1079130636 11:17745003-17745025 TGGTGTTGCTGTTGGTCAGAGGG - Intronic
1079303160 11:19297431-19297453 TGGTGCTGCTGATGGGGAGAAGG + Intergenic
1079407345 11:20158234-20158256 TGGTGGTGCTGGGGGGTGGGGGG + Intronic
1080870478 11:36232646-36232668 TGGTGGTGCTGGTGACCTATGGG - Intergenic
1081103027 11:39028764-39028786 TGGTGGTGGTGGCGGGGTGCTGG + Intergenic
1082957435 11:58885480-58885502 TGGAGGTGCTGGTGGACTCCTGG + Intronic
1083268091 11:61556267-61556289 TGGTGGTTCTGGAGGGCTCTGGG - Intronic
1083952654 11:65965479-65965501 TAGTGCTTCTGGTGGCCTGACGG + Intronic
1084002909 11:66307427-66307449 TGGTGGTGCTGGTGGTTTCTGGG + Intergenic
1084172397 11:67406792-67406814 TGGCGGTGCTGGCCTGCTGATGG + Intronic
1084288516 11:68146932-68146954 TGGTAGAGCTGGTAGGCTGGGGG + Intergenic
1084289850 11:68155615-68155637 TGGAGGTGCTGGAGGGCAGCGGG - Exonic
1084403372 11:68957322-68957344 TGGTTGTGCAGGTGGGCAGGGGG - Intergenic
1084460119 11:69292526-69292548 AGGTGGCGCTGATGGGCTGGTGG + Intergenic
1084466025 11:69323535-69323557 TGATGATGATGGTGGGGTGATGG + Intronic
1084466210 11:69324461-69324483 TGATGATGATGGTGGGGTGATGG + Intronic
1084686979 11:70702119-70702141 TGGTGGTGATGATGTGGTGATGG - Intronic
1084957167 11:72697600-72697622 TGCTGGTGCTGGTGGAGCGAAGG - Exonic
1084958586 11:72704244-72704266 TGGGGCTGCTGCTGGGCTGCAGG + Exonic
1084962930 11:72726738-72726760 TGGTGAAGCAGGTGGGCGGAAGG + Exonic
1085708341 11:78806863-78806885 TGGTGGTTGTCGAGGGCTGAGGG - Intronic
1086583617 11:88427163-88427185 TGATGGTGATGGTGATCTGATGG - Intergenic
1086932170 11:92705293-92705315 TGATGGTGGTGGTGTGATGATGG + Intronic
1086932175 11:92705316-92705338 TGGTGATGGTGGTGGTGTGATGG + Intronic
1086932200 11:92705431-92705453 TGGTGATGGTGGTGGTGTGATGG + Intronic
1086932217 11:92705519-92705541 TGGTGTTGGTGGTGGTGTGATGG + Intronic
1086932236 11:92705608-92705630 TGGTGGTGGTGGTGTGATGGTGG + Intronic
1086932254 11:92705709-92705731 TGGTGGTGGTGGTGGTGTGATGG + Intronic
1086932267 11:92705775-92705797 TGGTGATGGTGGTGGTGTGATGG + Intronic
1086932272 11:92705801-92705823 TGGTGTTGGTGGTGGTGTGATGG + Intronic
1086932278 11:92705827-92705849 TGGTGATGGTGGTGGTGTGATGG + Intronic
1086932288 11:92705873-92705895 TGGTGGTGGTGGTGGTGTGATGG + Intronic
1086932289 11:92705876-92705898 TGGTGGTGGTGGTGTGATGGTGG + Intronic
1086932294 11:92705899-92705921 TGGTGATGGTGGTGGTTTGATGG + Intronic
1087313331 11:96576912-96576934 TGGTGGTGGTGGTGGACACAGGG - Intergenic
1088489295 11:110371334-110371356 AGGTGGTGGTGGTGGGGTCAAGG + Intergenic
1088892394 11:114055360-114055382 TGGTGGTAGTGGTGGGGTGGGGG + Intergenic
1089528731 11:119113209-119113231 AGGGGGTGCTGGAGGGCTGAGGG - Intronic
1089534841 11:119154612-119154634 TTGTGGTGCTGCTGAGCTCAAGG + Intronic
1089540406 11:119186327-119186349 TGGTGGGGTTCGTGGGCAGAGGG - Intronic
1089609072 11:119659484-119659506 GGGTGGTGCTGGAGGGATGGAGG + Intronic
1090028432 11:123186924-123186946 TGCTGGTGCTGATGGCCTGGTGG + Intronic
1090272905 11:125400362-125400384 TGGGTGTGCAGGTGGGCTGAGGG - Intronic
1090858310 11:130630972-130630994 GGGAGGTGAGGGTGGGCTGATGG + Intergenic
1091292030 11:134446047-134446069 TGGTGGTGGTGGTGGGTGGGAGG + Intergenic
1202809659 11_KI270721v1_random:22185-22207 AGGAGGTGCTGGGGGGCTGCAGG + Intergenic
1091932019 12:4403692-4403714 TGGTGGTGGTGGTGGGGATATGG + Intergenic
1091977932 12:4841240-4841262 TGGTGATACTGGCTGGCTGATGG - Intronic
1092424882 12:8366948-8366970 TGGTGGTGGTGGTGGGAAGCTGG - Intergenic
1093370514 12:18359032-18359054 TGGGAGTGCTGAAGGGCTGAAGG + Intronic
1093607427 12:21109780-21109802 TAGTGGAGCTGGTAGGCTGCTGG - Intronic
1093752140 12:22812109-22812131 TGGTGGTGCAGCAGGGCTGGTGG + Intergenic
1094499912 12:31012143-31012165 TGGCTGGGCTGGAGGGCTGATGG - Intergenic
1094628200 12:32146424-32146446 TGGAGGTGCTGGTAGGCAGGTGG + Intronic
1095092317 12:38118759-38118781 TGATGGTGATGGTGGTATGATGG + Intergenic
1095808092 12:46343252-46343274 TGGTGGTGCTGGTGGACACAGGG - Intergenic
1095947853 12:47763953-47763975 AGGTGGTGATGCTGGGCTGGAGG + Intronic
1096596142 12:52696828-52696850 TGGAGGTGCTGGTGGGGGGTGGG - Intronic
1097189419 12:57212408-57212430 TGGTGAAGTTGGTGGGCTGCAGG - Exonic
1097197387 12:57250805-57250827 TGGGGGTGGGGGTGGGGTGAAGG - Intronic
1097268424 12:57759200-57759222 TGGTGGAGCTGGGGGGCTGGAGG - Exonic
1097881269 12:64688699-64688721 TTGTGGTGTTGGTGGGGGGATGG + Intronic
1098699117 12:73600448-73600470 TGGTGGTGGTGGTGGGGTAATGG - Intergenic
1100340898 12:93678350-93678372 TGGTGGTGCAGGTCTGATGAGGG + Intronic
1100563311 12:95770499-95770521 TGGAGGTGGTGGTGGGATCAGGG + Intronic
1101270574 12:103139700-103139722 GGGTGGTACTGGAGGGCTTAGGG + Intergenic
1101550013 12:105752927-105752949 TGGTGGACCAGGTGGTCTGAAGG - Intergenic
1101579829 12:106032699-106032721 TGGTGGTGGTGGTGGGGTGGGGG - Intergenic
1101863676 12:108503514-108503536 TGGTGGTGGTGAGGGGCTGGAGG + Intergenic
1101872700 12:108578948-108578970 TGGAGGTGGTGGTGAGATGATGG - Intergenic
1102140925 12:110614211-110614233 TGGTGGTGCTCCTGGGCTGCTGG + Exonic
1102601303 12:114032673-114032695 TGGTGGTGGTGGTGGTGTGGGGG + Intergenic
1102816562 12:115870583-115870605 TGGAGGTGGTGGTGGGGGGAGGG + Intergenic
1103332179 12:120161983-120162005 TGATGGTGCTGATGAGCTGTGGG + Exonic
1103871136 12:124092940-124092962 TGATGGTGATGGTGTGATGATGG + Intronic
1103871139 12:124092963-124092985 TGATGGTGATGGTGTGATGACGG + Intronic
1103871145 12:124093028-124093050 TGGTGATGATGGTGTGATGATGG + Intronic
1103871151 12:124093075-124093097 TGATGGTGATGGTGTGATGATGG + Intronic
1103871174 12:124093278-124093300 TGATGGTGATGGTGTGATGATGG + Intronic
1103871194 12:124093446-124093468 TGGTGATGGTGGTGTGATGATGG + Intronic
1104480018 12:129099568-129099590 AGTTGCTGTTGGTGGGCTGAAGG - Intronic
1104484338 12:129137018-129137040 TGGTGTTGATGGTGTGATGATGG - Intronic
1104511658 12:129384934-129384956 TTCTGTTGCAGGTGGGCTGATGG - Intronic
1104613310 12:130247920-130247942 TGGTGGTGATGATGTGATGATGG + Intergenic
1104624599 12:130340619-130340641 TGGTGGTGGTGGTTGGGGGAGGG + Intronic
1104657474 12:130584206-130584228 TGATGGTGGTGGTGAGGTGATGG - Intronic
1104657482 12:130584246-130584268 TGGTGATGGTGGTGAGGTGATGG - Intronic
1104657500 12:130584341-130584363 TGATGGTGGTGGTGAGGTGATGG - Intronic
1104657505 12:130584364-130584386 TGGTGATGGTGGTGAGGTGATGG - Intronic
1104657519 12:130584441-130584463 TGGTGGTGGTGATGAGGTGATGG - Intronic
1104974150 12:132544695-132544717 TGGTGGTGGTGGTGTGAGGATGG + Intronic
1105547155 13:21359317-21359339 TGATGGAGCTGGTGGTCTGGGGG - Intergenic
1105722902 13:23134626-23134648 TGGTGGTGATGGTGGGCCTGGGG - Intergenic
1105930811 13:25049770-25049792 TGGTGGAGGTGGTGGGGTGGGGG - Intergenic
1105956558 13:25288240-25288262 TGGTGGTGGTGGGGGGGTGGCGG + Intergenic
1106060140 13:26282527-26282549 TTGTAGTGCTGGTGTGGTGATGG - Intronic
1106666315 13:31854491-31854513 TGGTGAGGCTGGTGGGTAGAGGG + Intergenic
1107126889 13:36856035-36856057 TGGTGGTGCCAGGGGGCAGAAGG + Intronic
1107225649 13:38044958-38044980 TGGTGGCGATGGTGTGCTGGAGG - Intergenic
1107702185 13:43059592-43059614 TGTTGGAGCTTGTGAGCTGAAGG + Intronic
1107708599 13:43131266-43131288 TGATGCTGTTGGTGGGGTGAGGG - Intergenic
1108929895 13:55805742-55805764 TGGTGGTGGTGGTGGGGGGACGG + Intergenic
1110277099 13:73652788-73652810 TGTTGGGGTTGGTGGGGTGAAGG + Intergenic
1110339408 13:74371453-74371475 TGGTGGTGTTGGTTGGGTGGGGG - Intergenic
1110720781 13:78759080-78759102 TTTTGATGCTGGTGGGCTAAGGG - Intergenic
1112138814 13:96614495-96614517 TGGTGGGGATGGTGGGTTGAAGG + Intronic
1112340812 13:98551622-98551644 TGAAGGTGCTGGTGGGTAGAGGG - Intronic
1113472867 13:110559195-110559217 TGGGGGTGCAGGTGTGCAGAGGG - Intronic
1113512443 13:110866961-110866983 TGGTGGAGCTGTGGGGCTGTGGG - Intergenic
1113709117 13:112452530-112452552 TGGTGTTTCTGGGGGGCTGCTGG - Intergenic
1114089706 14:19273564-19273586 TGGTGGTGGTGGTGGTCATAGGG + Intergenic
1114375429 14:22141192-22141214 CAGTGGTGCTGCTGGGCTTATGG + Intergenic
1114551317 14:23534279-23534301 GGGTGGAGAGGGTGGGCTGAGGG + Exonic
1114618256 14:24079912-24079934 TGGTGGTGGTGGTGGTGAGAGGG + Intergenic
1115509530 14:34126121-34126143 TGGAGGAGCAGGTGGGGTGAGGG + Intronic
1115814900 14:37153284-37153306 TCTTGGTGCTGCTGGCCTGAAGG - Intronic
1117377752 14:55130741-55130763 TGGTGGTGGTGGTGGGGGGGGGG + Intronic
1117838266 14:59830120-59830142 GGGTGCTGCTGGTGGGCAGAGGG - Intronic
1117881327 14:60316211-60316233 TGGTGGGCCTGGTGGGCTGGTGG - Intergenic
1118329215 14:64802717-64802739 TGGTGTTGCTGCGGGGCTGGCGG - Intronic
1118570967 14:67195028-67195050 TGGAGATGTTGGTGGGGTGAGGG + Intronic
1118780093 14:69002182-69002204 TGGTGATGCTGAAGGGCTCATGG - Intergenic
1121145112 14:91576181-91576203 TGGTGGTGGTGGTGGGGGGCAGG + Intergenic
1121319990 14:92986663-92986685 TGGAGGGGTTGGTGGGCTGTGGG + Intronic
1121339253 14:93095182-93095204 TGGTGGTGGTGGTGGTATGTAGG - Intronic
1121732560 14:96196752-96196774 TGGTGTTAGAGGTGGGCTGAGGG - Intergenic
1121791738 14:96704312-96704334 TGGTGGTGGTGGTGGGATGCAGG + Intergenic
1121957527 14:98227702-98227724 AGGCAGTGCTGGTGAGCTGAAGG - Intergenic
1122157161 14:99756487-99756509 TGGTGTTCCTGGTGGGCTTTGGG + Intronic
1122175599 14:99916071-99916093 TGGTGGTCCAGGAGGGCTGAAGG + Intronic
1122180702 14:99952447-99952469 TGGTGGTGATGCTGAGGTGATGG + Intergenic
1122355472 14:101120670-101120692 TGGTGCTTCTGGTGGGCAGGTGG + Intergenic
1122378743 14:101286714-101286736 TGGGGGTGGGGGTGGGGTGAGGG - Intergenic
1122815042 14:104308040-104308062 TGATGGTGTGGCTGGGCTGATGG - Intergenic
1122856660 14:104563389-104563411 TGGGGGTGTTGGTGTCCTGAGGG - Intronic
1122970733 14:105151176-105151198 TGCTGGGGCTGCTGGGCTGCGGG - Intronic
1202846809 14_GL000009v2_random:185256-185278 TGGTGGGACTGCTGGGCTTAAGG + Intergenic
1202916269 14_GL000194v1_random:175857-175879 TGGTGGGACTGCTGGGCTTAAGG + Intergenic
1124209049 15:27747132-27747154 TGTTGGTGGTGGGGGGCTGGAGG - Intergenic
1124856132 15:33391129-33391151 TGGTGGGGCTGGAGGGATGAGGG - Intronic
1124940650 15:34214331-34214353 TGGTGGAGGTGGTGGGGGGAGGG + Intergenic
1125245687 15:37635754-37635776 TAGTGATGCTGATGGGGTGAGGG + Intergenic
1125603485 15:40927843-40927865 TGGTGGTGGTGGAGGACTGGGGG - Intergenic
1126034904 15:44536975-44536997 CGGTGGCGCTGCGGGGCTGAGGG - Intergenic
1126070572 15:44861906-44861928 TGGTGGTGCTGCCCAGCTGAGGG + Intergenic
1126144141 15:45461511-45461533 TGGTGGTGATGGTGTGGTGCTGG - Intergenic
1126144148 15:45461549-45461571 TGGTGGTGATGGTGTGGTGCTGG - Intergenic
1126144155 15:45461587-45461609 TGGTGGTGATGGTGTGGTGCTGG - Intergenic
1126144162 15:45461622-45461644 TGGTGGTGATGGTGTGGTGCTGG - Intergenic
1126144194 15:45461793-45461815 TGGTGGTGATGGTGTGGTGGTGG - Intergenic
1126144209 15:45461857-45461879 TGGTGGTGATGGTGTGGTGGTGG - Intergenic
1126144217 15:45461891-45461913 TGGTGGTGGTGATGGTGTGATGG - Intergenic
1126144231 15:45461950-45461972 TGGTGGTGATGGTGTGGTAATGG - Intergenic
1126144235 15:45461970-45461992 TGGTGGTGGTGGTGTGATGGTGG - Intergenic
1126144236 15:45461973-45461995 TGGTGGTGGTGGTGGTGTGATGG - Intergenic
1126144241 15:45461993-45462015 TGATGGTGTTGGTGGTGTGATGG - Intergenic
1126144247 15:45462022-45462044 TGGTGGTGATGGTGTGGTGGTGG - Intergenic
1126144261 15:45462083-45462105 TGGTGGTGATGGTGTGGTGGTGG - Intergenic
1126144274 15:45462133-45462155 TGGTGGTGGTGGTGTGGTGGTGG - Intergenic
1126144275 15:45462136-45462158 TGGTGGTGGTGGTGGTGTGGTGG - Intergenic
1126144293 15:45462205-45462227 TGGTGGTGGTGGTGTGGTGGTGG - Intergenic
1126144294 15:45462208-45462230 TGGTGGTGGTGGTGGTGTGGTGG - Intergenic
1126144316 15:45462298-45462320 TGGTGGTGATGGTGTGGTGGTGG - Intergenic
1126144342 15:45462405-45462427 TGGTGGTGGTGGTGTGGTGGTGG - Intergenic
1126144343 15:45462408-45462430 TGGTGGTGGTGGTGGTGTGGTGG - Intergenic
1126144358 15:45462478-45462500 TGGTGGTGATGGTGTGGTGGTGG - Intergenic
1126144380 15:45462562-45462584 TGGTGGTGGTGGTGTGGTGGTGG - Intergenic
1126144381 15:45462565-45462587 TGGTGGTGGTGGTGGTGTGGTGG - Intergenic
1126144403 15:45462655-45462677 TGGTGGTGATGGTGTGGTGGTGG - Intergenic
1126144429 15:45462762-45462784 TGGTGGTGGTGGTGTGGTGGTGG - Intergenic
1126144430 15:45462765-45462787 TGGTGGTGGTGGTGGTGTGGTGG - Intergenic
1126144444 15:45462832-45462854 TGGTGGTGATGGTGTGGTGGTGG - Intergenic
1126144453 15:45462864-45462886 TGGTGGTGATGGTGTGGTGGTGG - Intergenic
1126144467 15:45462919-45462941 TGGTGGTGATGGTGTGGTGGTGG - Intergenic
1126144480 15:45462974-45462996 TGGTGGTGGTGGTGTGGTGGTGG - Intergenic
1126144495 15:45463027-45463049 TGGTGGTGATGGTGTGGTGGTGG - Intergenic
1126144518 15:45463120-45463142 TGGTGGTGGTGGTGTGGTGGTGG - Intergenic
1126144532 15:45463175-45463197 TGGTGGTGGTGGTGTGGTGGTGG - Intergenic
1126144533 15:45463178-45463200 TGGTGGTGGTGGTGGTGTGGTGG - Intergenic
1126144546 15:45463245-45463267 TGGTGGTGATGGTGTGGTGGTGG - Intergenic
1126144582 15:45463392-45463414 TGGTGGTGATGGTGTGGTGGTGG - Intergenic
1126144586 15:45463409-45463431 TGGTGGTGATGGTGTGGTGGTGG - Intergenic
1126144608 15:45463506-45463528 TGGTGGTGATGGTGTGGTGGTGG - Intergenic
1126144618 15:45463544-45463566 TGGTGGTGATGGTGTGGTGGTGG - Intergenic
1126144625 15:45463570-45463592 TGGTGGTGATGGTGTGGTGGTGG - Intergenic
1126144634 15:45463602-45463624 TGGTGGTGATGGTGTGGTGGTGG - Intergenic
1126144643 15:45463634-45463656 TGGTGGTGATGGTGTGGTGGTGG - Intergenic
1126144650 15:45463660-45463682 TGGTGGTGATGGTGTGGTGGTGG - Intergenic
1126144657 15:45463686-45463708 TGGTGGTGATGGTGTGGTGGTGG - Intergenic
1126144709 15:45463922-45463944 TGGTGGTGATGGTGTGGAGATGG - Intergenic
1126319612 15:47407919-47407941 TGGTGGTGGTGGTGGGGTGGGGG + Intronic
1126678382 15:51181522-51181544 TGGTGGGGCTGGGGTGGTGAGGG + Intergenic
1126798825 15:52282162-52282184 TGTTGGTGCTGGTGTGGTGAGGG - Intronic
1127251854 15:57247145-57247167 TGGTGGTGGTGGTGGAGTGACGG - Intronic
1127546785 15:60000033-60000055 TTGCGGTGCTGGGGGGCTGGTGG + Intergenic
1127586596 15:60383634-60383656 TTGTGGTTGTGGTTGGCTGATGG + Intronic
1128337814 15:66798689-66798711 AGGTGATGCTGGAGGACTGAGGG + Intergenic
1128709590 15:69861696-69861718 TGGTGCTGCTGGTGTCCAGAGGG - Intergenic
1128739638 15:70074600-70074622 TGCTGGTGCTGGAGGGAAGAGGG + Exonic
1128845390 15:70890297-70890319 AGGTGGTGATGGTGGACAGATGG + Intronic
1129519958 15:76179352-76179374 TGGTGGGGCTGGTGGACTTCGGG - Intronic
1129655453 15:77521445-77521467 CGGTGGTGCTGGTTGCATGAGGG + Intergenic
1129676106 15:77633011-77633033 TGATGGTGGTGGTGGGGTGGGGG + Intronic
1129714932 15:77841606-77841628 TGGGGCTGCTGGTGGGGTTAGGG + Intergenic
1129850781 15:78792422-78792444 TGGTGGAGCTGCTAGGCTGCAGG - Intronic
1130042262 15:80414874-80414896 TGGTGGTGGTGGTGTGGTGGGGG + Intronic
1130699022 15:86160469-86160491 TGGTAGTGCTGGGGTGTTGATGG + Intronic
1130878221 15:88032473-88032495 TGGAGGTTCTGGTGAGCTCAGGG + Intronic
1131035918 15:89221926-89221948 TGGTGGTGGTGGTGGGGGGGGGG - Intergenic
1131279586 15:91009705-91009727 TGGTGGTGGGGGTGGGGTGGGGG + Intronic
1131312342 15:91302402-91302424 TGGTGATGCTGGTTGTCAGAGGG + Intergenic
1131577426 15:93605842-93605864 TGGAGGTGGTGGTGGGAGGATGG + Intergenic
1131762619 15:95640921-95640943 AGGTGGAGCTGGTGGTCTAAGGG - Intergenic
1131959305 15:97772556-97772578 TGGTGGTGGTGGTGGGCACAGGG - Intergenic
1132152721 15:99474120-99474142 GGGTAGGGCTGCTGGGCTGAAGG - Intergenic
1132155642 15:99493613-99493635 TGGTGTCCCTGGTGGGCTGACGG - Intergenic
1132445414 15:101912893-101912915 TGGTGGCTGTGGTGTGCTGAAGG + Intergenic
1132709886 16:1261755-1261777 TGCTGGGGCTGCTGGGTTGACGG - Intergenic
1132797544 16:1732704-1732726 TGGTGCTCCAGGTGGGCGGATGG - Intronic
1132797563 16:1732784-1732806 TGGTGCTCCAGGTGGGCGGATGG - Intronic
1132797581 16:1732864-1732886 TGGTGCTCCAGGTGGGCGGATGG - Intronic
1133269057 16:4601825-4601847 GGGTGGTGCTGGGGAGTTGAGGG + Intergenic
1133277025 16:4645151-4645173 TGGGGGTGGTGGTGGGGGGACGG + Intronic
1133385016 16:5362710-5362732 TGGTGGTTGTCGGGGGCTGAGGG - Intergenic
1133421433 16:5650335-5650357 TGGTGGTGGTGGTGGTGTGGAGG + Intergenic
1133582007 16:7153596-7153618 TGGTGATGGTGGTGGGGGGAGGG + Intronic
1134256743 16:12618698-12618720 TGGTGGTGGTGGGGGGATGGGGG - Intergenic
1135164430 16:20126242-20126264 TGGTGGTGGTGGTGGTGTGGTGG + Intergenic
1136102126 16:28004040-28004062 TGCTGGGGCTGCTGGGCTGACGG + Intronic
1136293499 16:29289521-29289543 TGGTGGGGTTGGTTGGCTGAGGG + Intergenic
1136679271 16:31946068-31946090 TGGTGGTGGTGGTGGACACAAGG + Intergenic
1136684051 16:31983829-31983851 TGGGGGTGGTAGGGGGCTGAAGG + Intergenic
1136778353 16:32883162-32883184 TGGTGGTGGTGGTGGGGAGGGGG + Intergenic
1136784677 16:32927381-32927403 TGGGGGTGGTAGGGGGCTGAAGG + Intergenic
1136885106 16:33926425-33926447 TGGGGGTGGTAGGGGGCTGAAGG - Intergenic
1136892267 16:33978352-33978374 TGGTGGTGGTGGTGGGGAGGGGG - Intergenic
1137768313 16:50994822-50994844 TGGTGGTGCTGGGGGGTTAGTGG + Intergenic
1137798239 16:51239730-51239752 TGGTGGAGGTGGTGGGATGGTGG + Intergenic
1137798255 16:51239789-51239811 TGGTGGAGGTGGTGGGATGGTGG + Intergenic
1138024423 16:53511637-53511659 AGGTGGTGGTTGGGGGCTGAGGG - Intergenic
1138389671 16:56661310-56661332 TGGTGGCGATGGTGCGCAGAGGG - Intronic
1139350563 16:66332488-66332510 TGATGCTGCTGATGGGGTGATGG - Intergenic
1139984912 16:70891011-70891033 TGGTGCTCCTGGCGTGCTGAAGG - Intronic
1140313736 16:73873071-73873093 TGGTGGTGGTGGTGGGTGGTGGG + Intergenic
1140313805 16:73873262-73873284 TGGTGGTGGTGGTGGGTGGTGGG + Intergenic
1140818773 16:78644299-78644321 AGGTAGTGCTGGTGGACAGATGG + Intronic
1140941148 16:79722899-79722921 TGGTGGTGATGGTGGGGAGGGGG + Intergenic
1140987375 16:80171242-80171264 TGGTGGTGCTGTGGTGGTGATGG - Intergenic
1141482139 16:84313644-84313666 TGGCGGGCCTGGTGGGTTGATGG - Intronic
1141799302 16:86296217-86296239 AGGTGGGGCTGGTGTGCTGTTGG + Intergenic
1141946535 16:87314581-87314603 TGATGGTGGTGGTGGGTTCAGGG + Intronic
1142099379 16:88263527-88263549 TGGTGGGGTTGGTTGGCTGAGGG + Intergenic
1203080775 16_KI270728v1_random:1145271-1145293 TGGTGGTGGTGGTGGGGAGGGGG + Intergenic
1143386586 17:6534600-6534622 TGGTGGTGGTGGGGGGCAGGGGG + Intronic
1144214347 17:13041932-13041954 TCATGATCCTGGTGGGCTGAGGG + Intergenic
1147144978 17:38479532-38479554 TGGGGGTGGTAGGGGGCTGAAGG + Intronic
1147580342 17:41624269-41624291 TGGGGGTGTTGATGGGCTGCTGG - Exonic
1147783819 17:42963690-42963712 TAGTGGTGCTGGGGGGCAGAGGG - Intronic
1147846363 17:43406850-43406872 TGGTGGCGGAGGTGGGCAGATGG + Intergenic
1147943368 17:44066123-44066145 TGGTGGTGGGAGGGGGCTGATGG - Intronic
1148150469 17:45394048-45394070 TGGTGGAGCTTGTGGTCTGATGG - Exonic
1148217183 17:45839685-45839707 TGCAGGTGTTGGTGAGCTGAGGG - Intergenic
1148872959 17:50669178-50669200 TGGTGGGGCCTGTGGGCTGTGGG + Exonic
1148907940 17:50923041-50923063 TGGGGGTGCTGGTTGTCTCAAGG + Intergenic
1149456485 17:56792716-56792738 TGGTGGTGATGGTGAGGTGGTGG + Intronic
1150065145 17:62102764-62102786 TGGTGGTCCTGTTGGCCTGGAGG + Intergenic
1150438118 17:65169826-65169848 TGGTGGTGGAGATGGGCTGGGGG - Intronic
1150556192 17:66256767-66256789 TGGTGATGCTGCTGGTCTGGGGG - Intergenic
1150685948 17:67320988-67321010 TGGAGGTTGTGGTGAGCTGATGG + Intergenic
1150961069 17:69912891-69912913 TGGGGCTGGTGGTGGGGTGAAGG - Intergenic
1151374973 17:73681967-73681989 TGGTGGTGAGGCTGGGCAGAAGG + Intergenic
1151887163 17:76929906-76929928 TGGTGGAGTTGGTGGAATGAAGG + Intronic
1152103986 17:78318417-78318439 TGGAGGTGCTGGTGGGAGTACGG - Intergenic
1152131289 17:78478192-78478214 TGGTGGTGGTGGTGATATGATGG - Intronic
1152541813 17:80980351-80980373 TGGAGGTGGTGCTGGGCTGGAGG - Intergenic
1152645135 17:81465274-81465296 TGGTGGGGCAGATGGCCTGATGG + Exonic
1152703145 17:81829343-81829365 TGGTGGCCCAGGTGGGATGAAGG - Intronic
1152735710 17:81995909-81995931 TGGTGGTGCCGGTGCCCGGAGGG + Intronic
1153233565 18:2964345-2964367 TGGTGGTGGTGGGGGACAGAGGG - Intronic
1153251138 18:3123111-3123133 TGGTGGTGCTGGGGGCATGGTGG - Intronic
1153317687 18:3740968-3740990 TGGTGGTGGTGGTGATGTGATGG - Intronic
1153317692 18:3740991-3741013 TGGTGGTGGTGGTGAGGTGATGG - Intronic
1153317704 18:3741035-3741057 TGGTGGTGGTGGTGAGGTGATGG - Intronic
1153387142 18:4510808-4510830 TGGTGGTGGTGGTGTGGTGGTGG + Intergenic
1155225322 18:23724917-23724939 TGGTGGTGCAGGAAGGCTGCAGG - Intronic
1155800911 18:30102374-30102396 TGCTGGTGCTGGTCGGCTTCTGG - Intergenic
1155872127 18:31042236-31042258 TGGTGGTGATGGTGGTTGGAGGG - Intronic
1156989072 18:43384511-43384533 TGGTGGTGAGGGTGGGTTCAGGG + Intergenic
1157513604 18:48295807-48295829 TCCTGCTGCTGCTGGGCTGAGGG - Intronic
1158315162 18:56204125-56204147 TGTTGGAGCTGTTGGGCAGAGGG - Intergenic
1159772197 18:72559125-72559147 GGGGAGTGCTGGTGGGCTGTGGG - Intronic
1160639894 19:120814-120836 TGGTGGCTGTGGTGTGCTGAAGG - Intergenic
1160672849 19:374384-374406 TGGTGGTGCTGGGGAGCTTCTGG + Exonic
1160761736 19:788901-788923 TGGTCGGGCTGGTGAGCAGATGG + Intergenic
1160859760 19:1232835-1232857 TGGTGGTGTTCGTGGGGTTATGG - Intronic
1161079953 19:2305735-2305757 TGGTTGTGGTGGGGGGCAGAGGG - Intronic
1161124258 19:2546974-2546996 CGGTGGTGCTCGGGAGCTGAAGG + Intronic
1161587889 19:5115268-5115290 TGGGGGTGCTGGGGGGATGTGGG + Intronic
1161836985 19:6654469-6654491 TGATGGTGGTGGTGGGTTGGTGG + Intergenic
1162035143 19:7934474-7934496 TGGGGGTGCCGGTGTGCTCATGG - Intronic
1163134446 19:15299468-15299490 TGGTGGTGGTGGTGGGTAGGGGG + Intronic
1163203722 19:15787259-15787281 TGGTGGTGGTGGTGGTGTCAGGG + Intergenic
1163401266 19:17094414-17094436 TGGTCGTGGTGGTGGGCTCATGG - Intronic
1163844250 19:19629499-19629521 TGGTGGTGCCTGAGGTCTGATGG - Exonic
1165118596 19:33544792-33544814 TGTTGGTGCTGATGGTCTGTTGG - Intergenic
1165224980 19:34348320-34348342 TGATGGTGCTTGTGAGGTGAAGG + Intronic
1165261711 19:34624623-34624645 TGGAAGTCCTGGTGGGCTGTTGG + Intronic
1165579457 19:36849929-36849951 TGCTTGTGCTGGTGGGATGAGGG - Intronic
1165732560 19:38155693-38155715 TGGGGGAGCTGGTGTGCTGATGG - Intronic
1165740604 19:38203198-38203220 AGATGGTGCTGCTGGGCTGAGGG + Intronic
1165832739 19:38737286-38737308 TGGGGGGGCTGGGGGGCTGCAGG - Exonic
1166046112 19:40232130-40232152 AGCTGGTGCTGTGGGGCTGAGGG - Exonic
1166088940 19:40495645-40495667 TGGTGGTGGTGGGGGGGTTAGGG - Intronic
1166359315 19:42246217-42246239 TGGTGGTGGTGGTGGGGTGATGG - Intronic
1166965395 19:46526837-46526859 TGGGGGTGGGGGTGGGCTCAAGG - Intronic
1167135396 19:47612609-47612631 TGTAGGGGCTGGGGGGCTGAGGG + Intronic
1167299251 19:48669775-48669797 TGGTGATGGTGGTGGTGTGATGG - Intronic
1167497944 19:49830296-49830318 TGTTGGAGCTTGTGGGATGATGG + Intronic
1167591407 19:50406375-50406397 TGGGTGGGCTGGTGGGCTGCGGG - Intronic
1168016122 19:53574509-53574531 TGCTGGTGCTGCTGGTCTGTGGG + Intronic
1168275590 19:55276411-55276433 TGCTGATGAAGGTGGGCTGAGGG - Intronic
925042945 2:747814-747836 TGGTGGTGATGGTGAGGTCAGGG - Intergenic
925042952 2:747855-747877 TGGTGGTGATGGTGAGGTCAGGG - Intergenic
925042959 2:747896-747918 TGGTGGTGATGGTGAGGTCAGGG - Intergenic
925067771 2:941973-941995 TGGTGGTTCTGGTGGGCAGGGGG - Intergenic
925570121 2:5301466-5301488 TGGTGGTGGTGGTGGGTGGAAGG - Intergenic
925734343 2:6948201-6948223 TGATGGTGCTGCAGGGCTGCAGG + Intronic
925796688 2:7553400-7553422 TGGTGGTCCTGTGGGGCTCAGGG - Intergenic
926096400 2:10083580-10083602 TGCTGGTGATGGTGGGTGGAAGG + Intergenic
926763657 2:16303290-16303312 TGGAGGTGCTGAGGTGCTGATGG - Intergenic
928121317 2:28585715-28585737 TGGTGATCTTGGTGGGATGAGGG + Intronic
928626210 2:33142467-33142489 GCGTGGTGGTGGTGGGCAGAGGG + Intronic
930735503 2:54774454-54774476 TGGTAGTGCTGTTGGCCAGAAGG - Intronic
931077069 2:58727200-58727222 TGGTGGTGGTGGTGGCTTGGGGG + Intergenic
931392465 2:61855466-61855488 TGGTGGTGGTGGTGGTGAGACGG - Intergenic
931464755 2:62476357-62476379 TGGTGGTAGTGGAAGGCTGAGGG - Intergenic
931812150 2:65864408-65864430 GGATGGTGCTGATGAGCTGACGG + Intergenic
932078980 2:68694239-68694261 TGATTTTTCTGGTGGGCTGATGG + Intronic
932513657 2:72322490-72322512 TGGTGGTGGTGGTGGGTACATGG + Intronic
932695036 2:73948839-73948861 TTGTGGTGGTGATGGGGTGAGGG - Intronic
932893128 2:75613060-75613082 GGGAGGTGCTGGTGGGAGGAAGG - Intergenic
933741463 2:85537975-85537997 TGGTCGGGCTGGTGGCCTGGTGG - Intergenic
933881453 2:86673976-86673998 TGCTGGTGCTGCTGGTCTGTAGG + Intronic
934033281 2:88066776-88066798 TGGTGATGCTGGTATGCTGGAGG - Intergenic
934149849 2:89135795-89135817 TGGTGATGCTGGGAGGCTGAGGG + Intergenic
934217448 2:90046236-90046258 CGGTGATGCTGGGAGGCTGAGGG - Intergenic
934527825 2:95062490-95062512 TGGTGGTGCTGTTGTCTTGAAGG - Intergenic
934981874 2:98849657-98849679 TGGTGGTCTTGGTGGTCTGGGGG - Intronic
935002110 2:99028628-99028650 TGGTGGTGATGAGGGGCTGGGGG - Intronic
935449296 2:103190486-103190508 TGGTGGTGATGTTGGCATGAGGG - Intergenic
936418985 2:112346262-112346284 TGGTGATGGTGGTGGTGTGATGG - Intergenic
936419075 2:112346663-112346685 TGGTGGTGATGGTGTGATGTTGG - Intergenic
936419110 2:112346823-112346845 TGGTGATGGTGGTGGTGTGATGG - Intergenic
936556477 2:113502091-113502113 TGGTGGGGCTGTGGGGCGGACGG - Intergenic
936667282 2:114610891-114610913 GGGGGGTGGTGGTGGCCTGAGGG - Intronic
936684474 2:114811655-114811677 GGGTGATGGTGGTGGGGTGAGGG - Intronic
936820894 2:116519425-116519447 TGGGTGTGGTGGTGGGCGGAGGG + Intergenic
937119165 2:119430259-119430281 TGTTGGTGCTGCTGGCCTGGGGG - Intronic
938069262 2:128299926-128299948 GGGTGGCTCTGGTGGGCAGAGGG + Intronic
938115269 2:128598327-128598349 TGGTGATGATGATGGGATGATGG - Intergenic
938262450 2:129905564-129905586 TGGAGGTGCTGGTTGCCTGATGG - Intergenic
938310362 2:130285282-130285304 AGCTGGTGCTGATGGTCTGAGGG + Intergenic
938444572 2:131367087-131367109 AGCTGGTGCTGATGGTCTGAGGG - Intergenic
938542537 2:132296410-132296432 TGGTGGTGCTGGAGAATTGAAGG - Intergenic
938561139 2:132472974-132472996 TGGTGGTGCAGGGGGGTTCACGG - Intronic
938570503 2:132557979-132558001 TGGTGGTGGTGGTGGGGTGGGGG + Intronic
938690231 2:133781283-133781305 TGGTGATGATGGTGAGGTGATGG + Intergenic
938992370 2:136642813-136642835 AGGTGGAACTGGAGGGCTGAGGG - Intergenic
939021062 2:136958981-136959003 TGGAGGTGCTGGTGGGGCTAGGG + Intronic
939785756 2:146509751-146509773 CTGGGGTGCTGGTGGGGTGATGG - Intergenic
939870943 2:147525272-147525294 TGATGGTGATGGTGGGATGCAGG - Intergenic
940240877 2:151562037-151562059 TGGTGGTGTCAGTGGGCTGATGG - Intronic
940622859 2:156134748-156134770 TGGTGGTGGTGGGGGGTGGAGGG - Intergenic
940845618 2:158638632-158638654 TGGGGGTGCAGGTGGGGTGAGGG + Intronic
941017343 2:160372335-160372357 TGGTGGTGGTGGTGGGTGTAGGG - Intronic
942484988 2:176429423-176429445 TGGTGGTGGTGGTGGTGTGGTGG - Intergenic
945263779 2:207870170-207870192 TGGTGGTGCTGAGGGAGTGAAGG - Intronic
945735393 2:213592985-213593007 TGGTGGTGTTGGTGGGGTGGGGG - Intronic
946166913 2:217869931-217869953 AGGTGGTGGAGGTGAGCTGAGGG - Intronic
946868618 2:224065534-224065556 TGGTGGTGGTGGTTGGGTGGTGG + Intergenic
947165099 2:227253753-227253775 TGGAGGTTCTGGCTGGCTGAGGG - Intronic
947463589 2:230323198-230323220 TGGTGATGCTCGTGAGCTGCTGG + Intergenic
947526318 2:230878673-230878695 AGCTCCTGCTGGTGGGCTGAAGG - Exonic
947621394 2:231593500-231593522 TGGTGGTGCTGGCAGCCTGAGGG - Exonic
947768411 2:232652054-232652076 GTGTGGTGCTGTTTGGCTGATGG - Intronic
947791501 2:232871786-232871808 TGGTGGTCCGTGTGGGCCGAAGG + Intronic
948233692 2:236370803-236370825 GGGTGGTGGGGGTGGGCTGGTGG + Intronic
948311913 2:236993829-236993851 AGGTGATGCTGGTGGGGTGCTGG - Intergenic
948464935 2:238147820-238147842 GGGTGGTGCCTGTGGGGTGAGGG - Exonic
948808645 2:240463650-240463672 GGGTGGTGCTGCAGGGTTGAGGG + Intronic
948873720 2:240816874-240816896 TGGGGGTGCTGTGGGGCAGAGGG - Intronic
948994647 2:241572233-241572255 TGGCGGTGCTGGGGGCCTGGCGG + Intronic
949017173 2:241720090-241720112 GGATGGTGCAGGTGGGCAGACGG + Intronic
1168949155 20:1784692-1784714 TTGTGGGGCTGGAAGGCTGAAGG + Intergenic
1169145157 20:3247713-3247735 TGGTGCTGCTGGTGGTGTAAGGG + Intergenic
1169263638 20:4154859-4154881 GGGTGGTGCAGGTGGGCTGGGGG + Intronic
1169284871 20:4299541-4299563 AGGATGTGGTGGTGGGCTGAGGG + Intergenic
1169346717 20:4834667-4834689 TTTCGGTGGTGGTGGGCTGATGG - Intergenic
1169698432 20:8418359-8418381 TGATGGTGGAGGTGGCCTGAAGG - Intronic
1169770208 20:9191741-9191763 TGGAGGTGCTGGAGGGGAGAAGG - Intronic
1170520468 20:17179869-17179891 TGCTGGTGCTGGTCTGCTGTGGG - Intergenic
1170941880 20:20854721-20854743 TGGAGGTGGTGGTGAGCTCAAGG + Intergenic
1171035576 20:21710076-21710098 TGGTGGTGGTGGTGGGCGGGTGG + Intronic
1171099274 20:22367413-22367435 TGGGGGTGGAGGTGGGATGAGGG + Intergenic
1171316695 20:24201824-24201846 TGGAGGTGCTGCTGGGGTAAAGG - Intergenic
1172449795 20:35013882-35013904 TGGTGCTGCTGGTGGGTGAAGGG + Intronic
1172527280 20:35607532-35607554 TGGGCGGGCTGGTGGGCAGAAGG - Intergenic
1173018156 20:39245490-39245512 TGGTGGTTCTTGTGGACTGAAGG + Intergenic
1173177096 20:40772686-40772708 TGGTGGTGATGGTGGGCTGGTGG - Intergenic
1173319967 20:41978536-41978558 TGGTGATGCTGCTGGTCTGGAGG + Intergenic
1173326529 20:42038548-42038570 TCATGGTGATGGTGGGCTTATGG + Intergenic
1173803508 20:45909872-45909894 TGGAGGTGCTGTGGGGCTGTGGG - Intronic
1174183382 20:48688918-48688940 TGGTGGTGGTGGAGGGCAGGTGG - Intronic
1174205482 20:48835161-48835183 AGGTGTTGCAGGTGGGCTGTGGG + Intergenic
1174528736 20:51194117-51194139 TGGTGTTGCTGCTGGGAGGAGGG + Intergenic
1174783315 20:53410293-53410315 TGGTGGAGCTGGTGGTTTGAAGG - Intronic
1175281425 20:57806607-57806629 CGGTGGGGCTGGTGGGCTCAGGG - Intergenic
1175319980 20:58078676-58078698 TGGTGGTGATGGTTGGGTGGGGG - Intergenic
1175404423 20:58717244-58717266 TGGCGGTGCTGGGGGGCAGGTGG + Intronic
1175420593 20:58830139-58830161 TGGTGGTGGTGGTGGTATGGTGG - Intergenic
1175420621 20:58830275-58830297 TGGTGGTGATGGTGGTGTGGCGG - Intergenic
1175420636 20:58830342-58830364 TGGTGGTGATGGTGGTGTGGTGG - Intergenic
1175420676 20:58830527-58830549 TGGTGGTGCTGATGGTATGATGG - Intergenic
1175420683 20:58830565-58830587 TGGTGGTGGTGGTGTGGTGGTGG - Intergenic
1175420694 20:58830609-58830631 TGGTGGTGATGGTGGTGTGGTGG - Intergenic
1175420702 20:58830640-58830662 TGGTGGTGATGGTGGTGTGGTGG - Intergenic
1175442892 20:59003373-59003395 AGATGGGGCTGGTGGGATGAAGG - Intronic
1175632660 20:60555352-60555374 TGGTGGTATGGGTGGGCTGCTGG + Intergenic
1175734522 20:61376097-61376119 TGGTGGTGATGGTGGAGTGGTGG + Intronic
1175746093 20:61458369-61458391 TGGTGGTGATGGTATGGTGATGG + Intronic
1175909543 20:62398197-62398219 TGGTGGTGATGGTGATGTGATGG + Intronic
1176176650 20:63730136-63730158 TGATGGTGTGGGTGTGCTGAAGG + Intronic
1176421288 21:6518157-6518179 TGGTGGAGGTGGTTGGCTCACGG + Intergenic
1176635623 21:9190503-9190525 TGGTGGGACTGCTGGGCTTAAGG + Intergenic
1176872891 21:14098165-14098187 TGATGGTGATGGTGGTATGATGG - Intergenic
1177227247 21:18273060-18273082 AGGTGGTGCTGCTGGACTGGAGG + Intronic
1178041451 21:28644433-28644455 AGGTGGTGGTGGTGGGATGGTGG - Intergenic
1178399809 21:32275846-32275868 AGGTGGTGCTGGTGGTTTGGGGG - Intronic
1179031832 21:37727310-37727332 TGGTGGTGTTGGTGGAGTGGTGG + Intronic
1179393196 21:41012365-41012387 TGGTGGTCATGGTGAGCTGGTGG - Intergenic
1179634408 21:42698186-42698208 AGGTGTTGCTGGTGGGGTGTGGG - Intronic
1179696778 21:43126472-43126494 TGGTGGAGGTGGTTGGCTCACGG + Intergenic
1179721154 21:43316591-43316613 CCGTGGAGCTGGGGGGCTGAGGG + Intergenic
1179910135 21:44443084-44443106 TGGTGACGCTGATGGGGTGAGGG - Intergenic
1179971362 21:44838002-44838024 TGGTGGTGCTGCGAGGCTCATGG - Intergenic
1180188849 21:46153285-46153307 TGCTGCTGCTCCTGGGCTGAAGG - Intronic
1180371190 22:12038777-12038799 TGGTTGTACTGCTGGGCTTAAGG + Intergenic
1180490998 22:15848783-15848805 TGGTGGTGGTGGTGGTCATAGGG - Intergenic
1181033722 22:20160141-20160163 TGGAGGAACTGGTGGGCTGCAGG - Intergenic
1181033735 22:20160201-20160223 TGGAGGAACTGGTGGGCTGGAGG - Intergenic
1181033751 22:20160252-20160274 TAGAGGAGCTGGTGGGCTGGAGG - Intergenic
1181034599 22:20163830-20163852 TGGTGGTAGTGGTGGGGTGGTGG - Intergenic
1181509161 22:23381305-23381327 TGGTGGTGATGGGGTGCTGGTGG + Intergenic
1181725977 22:24811216-24811238 TCCTAGTGGTGGTGGGCTGAGGG - Intronic
1182358116 22:29731414-29731436 TGGTGAGGCAGGTGGGCTGGGGG - Exonic
1183315667 22:37135688-37135710 TGGGGGTGGTGGGGGGCTGTAGG - Intronic
1183320909 22:37164483-37164505 TGGTGGGGGTGGTGGGCAGGGGG + Intronic
1183742214 22:39675054-39675076 TGGGGGTGATGCTGGGCTGCAGG + Intronic
1184037608 22:41926162-41926184 TGGTGGGTCTGGTGAGCTGGAGG - Exonic
1184286623 22:43475528-43475550 TGGTGGTGGTGGTGATGTGATGG + Intronic
1184723665 22:46330559-46330581 TGCTGGAGAGGGTGGGCTGAGGG + Exonic
1184741604 22:46431855-46431877 TGCAGGGGCTGGTGGGGTGAGGG - Intronic
1184860912 22:47172941-47172963 TGATGGTGCTGGTGCCCGGAGGG + Intronic
1185370601 22:50459231-50459253 TGAGGGTGCTTGTGGGCAGACGG - Intronic
1203245066 22_KI270733v1_random:60216-60238 TGCTGGTGTTGTGGGGCTGATGG + Intergenic
949158212 3:851800-851822 TGGTGGTGGTGGTGGTGTGGAGG + Intergenic
949404056 3:3696353-3696375 TGGTGATGCTGGTGGAAGGAAGG + Intergenic
949908389 3:8878762-8878784 TGGGGGTGCAGGTGAGCTGCTGG - Exonic
950202862 3:11057199-11057221 TGGGGGTGGTGGTGGCCAGAAGG - Intergenic
950357764 3:12425940-12425962 TGGTGGTGCTGTTGAGTGGAGGG + Intronic
950667270 3:14505243-14505265 GGATGGTGCCGGTGGGCTGAGGG + Intronic
950694724 3:14690149-14690171 TGGTGGTGGCGGTGGGGTGGGGG + Intronic
950697647 3:14715579-14715601 TGGTGGTCCAGGTTGGCTGAAGG + Intronic
950791589 3:15476728-15476750 AGGTGGTGTTGGCTGGCTGAAGG - Intronic
950870323 3:16222784-16222806 TGGTAGTGCTGCTGGTCAGAAGG + Intronic
950914419 3:16629258-16629280 TGGTGATGATGGTGGCTTGAAGG + Intronic
951445430 3:22774387-22774409 TAGTAGTGCTGGTGATCTGACGG - Intergenic
953351734 3:42221331-42221353 TGGGGATGCTGGTGGGCTGGGGG - Intronic
953374045 3:42413658-42413680 TGGGGGTGCTGGTGGGCAGGGGG - Intergenic
953820750 3:46205746-46205768 TGGTGGTGGTGGGAGGGTGATGG - Intronic
954118199 3:48478763-48478785 TGGTGATGGTGATGGGGTGATGG - Intronic
956332553 3:68127604-68127626 TGGTGGTGGTGGTGTGATGATGG + Intronic
956332560 3:68127651-68127673 TGGTGGTGGTGGTGTGATGATGG + Intronic
956332565 3:68127674-68127696 TGGTGGTGGTGGTGTGATGATGG + Intronic
956422784 3:69101877-69101899 TGGTGGTGCTGGTGTTCACAGGG + Exonic
957068897 3:75550062-75550084 TGGTGGTGGTGGTGGGAAAATGG - Intergenic
957198786 3:77105404-77105426 TGGTGGTGATGGTGGGTGGTAGG + Intronic
957374686 3:79340487-79340509 TGGATGTGATGGTGGGCTGCAGG + Intronic
957398416 3:79676064-79676086 TGGTGGTGGTGGTGGTTTTACGG + Intronic
959160019 3:102711906-102711928 TGGTGGTGGTGGTGGGCAGAAGG + Intergenic
959419346 3:106111839-106111861 ACGGGGTGCTGGCGGGCTGAGGG + Intergenic
959663645 3:108897261-108897283 TGGTGGAGCGGGTGGGAGGAAGG + Intergenic
960486844 3:118263199-118263221 TGGTGGTGCTGGGAAGCTGCAGG - Intergenic
960695219 3:120389252-120389274 TGGTCATGCTGGAGGCCTGAGGG - Intergenic
960811959 3:121634392-121634414 TAGTGGTACCCGTGGGCTGAAGG - Exonic
961125696 3:124415788-124415810 TGCTGGTGCTGCTGGGCCCAGGG - Intronic
961534766 3:127563678-127563700 TGGTGGTGCTGGTAGGATGGTGG - Intergenic
961534772 3:127563701-127563723 TGGTGGTGCTGGTAGGATGGTGG - Intergenic
961534778 3:127563724-127563746 TGGTGGTGCTGGTAGGATGGTGG - Intergenic
961643272 3:128378590-128378612 TGGTGGTACTAGTGGTCTGGGGG + Intronic
961821412 3:129577457-129577479 GGGTGGGGCTTGAGGGCTGAGGG + Intronic
961937677 3:130603103-130603125 TAGTGTTGCTGGTGGACTGTAGG - Intronic
962135697 3:132729836-132729858 TGGTGGTGAGGGGGGGCTGGAGG - Intergenic
962267886 3:133956278-133956300 TGCCGGTGCTGTTGGGCTCAGGG + Intronic
962438150 3:135385274-135385296 TGGTGGTGCTCTGGGGCTGTGGG - Intergenic
963678238 3:148341411-148341433 TGGTGGTGATGGTGTGCTAAAGG + Intergenic
964080334 3:152746457-152746479 TGGTAGTCCTGGTAGGCTGCAGG - Intergenic
965759469 3:172060339-172060361 TAGTGGTGGTGGTGGGCAGAGGG + Intronic
966082864 3:176026208-176026230 TGGTGGGGGTGCTGGGGTGAGGG + Intergenic
966925799 3:184643857-184643879 TGGGGGTGCTGGGGGACTGAAGG - Intronic
967117581 3:186355582-186355604 TGGTGGTAGTGGTGGGGTGATGG - Intronic
967158982 3:186718299-186718321 TGGTGGTGGTGGTGGGTGGTGGG - Intronic
967158995 3:186718332-186718354 TGGTGGTGGTGGTGGGTGGTGGG - Intronic
968220505 3:196934838-196934860 TGATGGTGCTGCTGCTCTGAGGG - Intergenic
968340339 3:197950363-197950385 TGGAGGAGATGTTGGGCTGATGG + Intronic
968518387 4:1024227-1024249 TGGGGGTGCTGGTGGGCCCAGGG + Intronic
968602565 4:1517266-1517288 TGTGGCTGCTGGTGGGCGGAGGG - Intergenic
969265817 4:6063525-6063547 GGCTGAGGCTGGTGGGCTGACGG + Intronic
969280897 4:6170254-6170276 TGGTGGTGGTGGTGGTGAGAAGG - Intronic
969280917 4:6170341-6170363 TGGTGGTGGTGGTGGTGAGAAGG - Intronic
969506529 4:7591474-7591496 AGGTGGTGCTGGCAGGCTGGTGG + Intronic
969522166 4:7684810-7684832 TGGTGGTGGTGGTGGGGAGGGGG - Intronic
969529795 4:7724314-7724336 TGGTGGTGGTGATAGGGTGATGG + Intronic
969701241 4:8768915-8768937 CTGTGGTGCTGGTGGCCTGCAGG - Intergenic
971210622 4:24612504-24612526 TGGAGGTGCTGGAGGTATGAAGG + Intergenic
971228755 4:24779972-24779994 TAGTGGTGCTGGTTGGGGGACGG + Intergenic
971635044 4:29047429-29047451 TGGTGGGGCGGGGGGCCTGAAGG - Intergenic
972009498 4:34158891-34158913 TGGTGGTGGTGGTGGCCACAGGG + Intergenic
972404441 4:38733185-38733207 TGGTGGTAATGGTGGGATGGTGG + Intergenic
972404637 4:38734159-38734181 TGGTGGTGATGGTGGCCTGGTGG + Intergenic
972642229 4:40935518-40935540 TGGTGGTGGGGGTGGAATGAGGG + Intronic
972905962 4:43747382-43747404 TGGTGGTGGTGGTGGGTGAAGGG + Intergenic
974770327 4:66403597-66403619 TGGTGGTGGTGGTGGACATAGGG - Intergenic
974877190 4:67714864-67714886 TGGTGGTCCTGGTGTGTTGGTGG - Intergenic
977044451 4:92051452-92051474 TGGTAGTGGTTGTGGGGTGAGGG + Intergenic
977830663 4:101588215-101588237 TGGTTGTCTTGGTGGGATGAGGG - Intronic
977877662 4:102167888-102167910 TGATTGTGCTGGTGGGCATATGG + Intergenic
981298062 4:143156037-143156059 TTGTGGTGGTGGTGGGCACAGGG - Intergenic
981472714 4:145154834-145154856 TGGTGGTGGTGGGGGGCGGGGGG + Intronic
981552865 4:145959444-145959466 TGGTGGTGGTGGTGGGTGGATGG + Intergenic
982278763 4:153663075-153663097 TGGTGGTGATGGTGAGTTGATGG + Intergenic
982368702 4:154609194-154609216 TGGTGATGGTGGTGGGGTGGTGG + Intronic
983058618 4:163129056-163129078 TGGTGGGGGTGGAGGGCGGAGGG + Exonic
983593581 4:169441493-169441515 TGGTGGTGGTGGTAGGCAGGAGG - Intronic
985452973 4:190070940-190070962 TGGTGGTGGTGGTGGGGGGGGGG - Intergenic
985453962 4:190074233-190074255 TGGTGGTGGTGGTGGGGGGGGGG - Intergenic
985454950 4:190077526-190077548 TGGTGGTGGTGGTGGGGGGGGGG - Intergenic
985455938 4:190080823-190080845 TGGTGGTGGTGGTGGGGGGGGGG - Intergenic
985456921 4:190084117-190084139 TGGTGGTGGTGGTGGGGGGGGGG - Intergenic
985457909 4:190087413-190087435 TGGTGGTGGTGGTGGGGGGGGGG - Intergenic
985458897 4:190090710-190090732 TGGTGGTGGTGGTGGGGGGGGGG - Intergenic
985463148 4:190173472-190173494 TGGTGGTGGTGGTGGGGGGGGGG - Intergenic
985631664 5:1017258-1017280 AGGCGGTGATGGTGGGCAGAGGG - Intronic
985970913 5:3377679-3377701 TGGAGGTGCTGGGAGGCTGATGG + Intergenic
986495566 5:8338485-8338507 AGGTGGTGGTGGTGGGAGGAGGG - Intergenic
988696412 5:33626552-33626574 TGGTGGTGGTGGTGATGTGATGG + Intronic
988696422 5:33626601-33626623 TGGTGGTGGTGGTGAGGTGACGG + Intronic
988696528 5:33627187-33627209 TGGTGGTGATGGTGGGGTGATGG + Intronic
988696535 5:33627219-33627241 TGGTGGAGATGGTGGAGTGATGG + Intronic
988696557 5:33627312-33627334 TGGTGGGGATGGTTGGGTGATGG + Intronic
988819149 5:34863379-34863401 TGGTGGTGGTGGTGTAGTGATGG + Intronic
988906648 5:35797561-35797583 TGGTGGGGCTGTTGTGCAGAGGG + Intronic
988976441 5:36521208-36521230 TGGTGGTGGTGGTGAGGTGATGG + Intergenic
990139561 5:52688079-52688101 TGCTGATGCTGATGGTCTGAAGG + Intergenic
990289183 5:54331324-54331346 TGGTGTTGGTGGTGGGCGGGGGG - Intergenic
990637990 5:57750759-57750781 TGGGGGAGCTGGTAGGCAGATGG + Intergenic
991137917 5:63205054-63205076 TGGTGGTGGTCGTGGGTAGAAGG + Intergenic
992441896 5:76804309-76804331 TGGGAGAGCTGGTGGGCAGAGGG - Intergenic
993131164 5:83900080-83900102 TAGTGGTGGTGGTGGGAGGATGG - Intergenic
993431727 5:87841015-87841037 TGGTGGTAGTGGCAGGCTGATGG + Intergenic
994614816 5:102091067-102091089 AGATGGTCCTGGTGAGCTGAAGG - Intergenic
995124008 5:108562240-108562262 TGGTGATGGTGGTGGGGTGGGGG - Intergenic
995188737 5:109298487-109298509 TGGTGGTGGTGGTGGGCGGGGGG - Intergenic
995246899 5:109945095-109945117 CGGTGTTGCTGGAAGGCTGAGGG + Intergenic
995596223 5:113751073-113751095 TGGTGGTTGTGGTGGGGTGGGGG + Intergenic
995650487 5:114362710-114362732 TGGTGGTGCTGGTGGTGCGCCGG - Exonic
997022630 5:130019419-130019441 TGGTGGTGGTGGTGGGGTGTTGG - Intronic
997201307 5:132011613-132011635 TGCTGGGGCTGCTGGGCTGCGGG - Exonic
997236105 5:132272713-132272735 TGGGGGTGGTGGTGGGGTGCTGG + Exonic
997280810 5:132643708-132643730 TGGGGGTGGTGGTGGGGTGGGGG + Exonic
997852868 5:137348025-137348047 TGCTGCTGCTGCTGGGCTGTGGG + Intronic
998655281 5:144171564-144171586 TGGTGGTGGTGGTTGGTTGGGGG - Intronic
998910929 5:146959559-146959581 TGGTGGTGCTGGGGAACTGCAGG + Intronic
999105448 5:149067017-149067039 TGGTGATGGTGGTGAGTTGAAGG - Intergenic
999185676 5:149706609-149706631 TGGTGGTGGTGCTGGGGTGAAGG + Intergenic
1000632006 5:163601417-163601439 TGGTGGTGGTGGTTGGCTAGGGG + Intergenic
1002747244 6:69221-69243 TGGTGGCTGTGGTGTGCTGAAGG - Intergenic
1003081806 6:3027377-3027399 TGGTGGTGGTTGTGGGGTGAGGG - Intergenic
1003106656 6:3221971-3221993 TGGTGGTGGTGATGTGGTGATGG - Intergenic
1003404522 6:5817396-5817418 TGGTGGAGCTGGTGGTCTGGAGG + Intergenic
1003675631 6:8202112-8202134 TGGGGGTGCTGGTGGGCAGAAGG - Intergenic
1004252510 6:14033798-14033820 TGGGGGAGCTTGTGAGCTGATGG - Intergenic
1004525088 6:16399984-16400006 TGCTGATGCTGCTGGGCTGTGGG - Intronic
1005385831 6:25283311-25283333 TGGAGGTGACAGTGGGCTGATGG + Intronic
1006002078 6:30972888-30972910 AGGTGTTGCTGGTTGGCTCACGG - Intergenic
1006009744 6:31032389-31032411 AGGTGCTGCTGGTTGGCTCACGG - Exonic
1006051452 6:31348058-31348080 TGGAGGTGGTGGAGGGCAGAGGG - Intronic
1006180474 6:32150792-32150814 TGGTGGTGATGGTGTGAGGAAGG + Exonic
1006295469 6:33168253-33168275 TGCAGGAGCTGGTGGGTTGATGG - Intronic
1006340377 6:33443412-33443434 TGGTGGTGGTGATGGGAGGAAGG - Exonic
1006357287 6:33567414-33567436 TGGTGGTGGTGGTGGTGTGCTGG + Intergenic
1007073338 6:39051643-39051665 TGGTGGTGGTGGTTGGAGGAGGG + Intronic
1007092659 6:39193790-39193812 AGTGGGTGCTGGTGGGCTCAGGG + Intronic
1007634997 6:43294283-43294305 TGGTGGTGGTGATGTGGTGATGG - Intergenic
1007635002 6:43294315-43294337 TGGTGGTGGTGATGTGGTGATGG - Intergenic
1007635026 6:43294489-43294511 TGGTGGTGGTGATGTGGTGATGG - Intergenic
1007635047 6:43294628-43294650 TGGTGGTGGTGGTGATGTGATGG - Intergenic
1007706685 6:43795457-43795479 TGGTGCTGGTGGTGGGTGGAGGG + Intergenic
1007742555 6:44021752-44021774 TGGTGGTGCTGGGGGAGGGAAGG - Intergenic
1007743126 6:44024971-44024993 TGGTGGTGCTGGGGGAGGGAAGG - Intergenic
1007748113 6:44055637-44055659 TGGGGATGCTGGCGGGGTGAGGG - Intergenic
1008707505 6:54181274-54181296 TGGTGGTGTTGGTGGCCACAGGG - Intronic
1008964056 6:57296608-57296630 TGGTGGTGGTGGTAGGGTGGTGG + Intergenic
1009899296 6:69792318-69792340 GGGTGATACTGGTGGGCTGAGGG - Intronic
1010877720 6:81128403-81128425 TGCTGATGCTGATGGTCTGAGGG - Intergenic
1010994619 6:82519091-82519113 TGGTGGTGATGGTGAGATGGTGG + Intergenic
1011807275 6:91086283-91086305 TGGTGATGGTGGTGGGGTAACGG + Intergenic
1013236349 6:108200357-108200379 TGGCGGTGGTGGTGGGGGGACGG + Intergenic
1013606386 6:111752862-111752884 TGGTGGTGAGGGTGGGATGGAGG + Intronic
1013925738 6:115469141-115469163 TGCTGCTGCTGCTGGGGTGAGGG + Intergenic
1015301326 6:131655841-131655863 GGGTGGTGGTGGTGGTCAGAAGG + Intronic
1015497114 6:133893444-133893466 GGGTGGCGGTGGTGGGGTGATGG - Exonic
1016237661 6:141887635-141887657 TGGTGGTGGTGTGGGGCAGAGGG - Intergenic
1018458803 6:163977802-163977824 TGGTGGTGCAGGTGGGCCCTAGG + Intergenic
1018622904 6:165749217-165749239 TGGTGGTGATGGTGATATGATGG - Intronic
1018786756 6:167114280-167114302 TGGTGGAGATGGTGGTTTGATGG + Intergenic
1018848672 6:167572402-167572424 TGGTGGGGCTGGTGGGGTTGAGG - Intergenic
1019415440 7:924713-924735 TGGGGGTGCTCGTGGACTCAGGG - Intronic
1019462035 7:1164997-1165019 TGGTTGTGATGGTGAACTGAAGG - Intergenic
1019707751 7:2504673-2504695 AGGTGAGGCTGGTGGGCTGCAGG - Intergenic
1019810881 7:3164358-3164380 TGGGGGAGCAGGTGAGCTGAAGG - Intronic
1020381991 7:7557217-7557239 TGGTGGTGGTGGTGGGGAGGTGG - Intergenic
1021657223 7:22883959-22883981 TGATGGGGTTGATGGGCTGATGG - Intergenic
1022209338 7:28193595-28193617 TGGTGGTGGTGTTGGGGTGGGGG - Intergenic
1022339696 7:29456613-29456635 TGGTGGTGGTGGTGGGGGGGAGG - Intronic
1022900700 7:34807886-34807908 TGGTGGTGGTGGTGGGGGGTAGG - Intronic
1022941398 7:35243797-35243819 TGGTGGTGCTGTTGGGATATTGG - Intronic
1023051747 7:36258666-36258688 TGCTGGAGCTGGTGGGGGGAGGG - Intronic
1023143916 7:37130198-37130220 AGGTGGTGGTGGTGGGGTGGGGG - Intronic
1023235627 7:38082878-38082900 TGGTGGTGGTAATGGGCTGAAGG + Intergenic
1023353072 7:39339725-39339747 TGCGGGTGCTGGTTGGTTGACGG - Exonic
1023562614 7:41491526-41491548 TTGTGGTGCTGGTGACCTGAGGG + Intergenic
1023703839 7:42918701-42918723 TGATTGGGCTGGTGGGCTGAGGG - Intronic
1023837085 7:44074515-44074537 TGGTGGTGCTGGAGCCCTGGGGG + Exonic
1025206565 7:56996504-56996526 TGCTGGTGCTGGTGGGGTTGAGG + Intergenic
1025665373 7:63580423-63580445 TGCTGGTGCTGGTGGGGTTGAGG - Intergenic
1026286453 7:68967741-68967763 TGGTGGTGATGATGTGATGATGG + Intergenic
1026436753 7:70405999-70406021 TGGTGGTGGTGGCGGCCTGGTGG + Intronic
1026960489 7:74404501-74404523 TGTTGGTGTTGGTGGGCAGCGGG - Exonic
1027338743 7:77182863-77182885 TGGTGGTGATGATAGGGTGAAGG - Intronic
1029171246 7:98630463-98630485 AGGTGGTGGTGGTGGGCGGTGGG - Intergenic
1029196783 7:98810990-98811012 TGGTGGTGGTGGTGTGGTGGTGG + Intergenic
1029524711 7:101087749-101087771 TGGTGGACCTGGTGGGCTACAGG + Exonic
1030993567 7:116330955-116330977 TGGTGGTGGTGGTGGTTTGTTGG - Intronic
1032163917 7:129531116-129531138 TGGTGGTGGTGGTGGTGTGTGGG + Intergenic
1032268978 7:130386880-130386902 AGGTGGGGCAGGTGGGTTGAAGG + Intronic
1032442719 7:131954324-131954346 TGGTGGTGGAGGTGGGGGGAAGG + Intergenic
1032454496 7:132063216-132063238 TCTTGGTGCTGGTGGGCCAAGGG + Intergenic
1034046704 7:147937033-147937055 TGGTGGTGGTGAGGGGGTGAGGG - Intronic
1034213866 7:149388241-149388263 GGGTGGCGCTTGTTGGCTGATGG + Intergenic
1034271259 7:149804343-149804365 AGGTGAGGCTGGTGGGTTGAGGG + Intergenic
1034631273 7:152532335-152532357 TGGAGGTGGTGGTAGCCTGAAGG - Intergenic
1034883273 7:154778630-154778652 TGGTGGTGGTGGTGTGGTGGTGG - Intronic
1034883348 7:154779008-154779030 TGGAGGTGATGGTGGGGTGCTGG - Intronic
1035034612 7:155886668-155886690 GGGTGGGGCTGGCGGGGTGAAGG + Intergenic
1035918524 8:3651949-3651971 TGGTGGTGATGGCGCTCTGATGG - Intronic
1035918561 8:3652209-3652231 TGGTGGTGATGGCGCTCTGATGG - Intronic
1036126468 8:6067670-6067692 TGGTGGAGCTGTTGGGATCACGG + Intergenic
1036469625 8:9040866-9040888 GCTTGGTGCTGGCGGGCTGATGG - Intronic
1037179800 8:15992166-15992188 TCGTGGTGGTGGTGGGTAGAGGG + Intergenic
1037313701 8:17581518-17581540 TGGTGGTGGTGGTGGGAGGTAGG + Intronic
1037496272 8:19443884-19443906 TGGGGGTGGAGGTGGGCTTATGG + Intronic
1037735296 8:21561116-21561138 TGGTGGTGGTGGTGGGGTTATGG - Intergenic
1037762683 8:21752380-21752402 CAGTGCTGCTGATGGGCTGAGGG - Intronic
1037949817 8:23011637-23011659 AAGTGGTGCTCGTGGGGTGAAGG + Intronic
1037988674 8:23305510-23305532 GGGTAGTGCTGGTGGGCGGGGGG - Intronic
1038418458 8:27415251-27415273 GGGTGGTGGTGGTGGGTGGATGG + Intronic
1039102898 8:33959362-33959384 TGGTGGTGCTGGTGATCTTGGGG + Intergenic
1040286071 8:46101072-46101094 GGGTGGTGTGGGTGGGCTGCAGG - Intergenic
1040300863 8:46187346-46187368 GGGTGGTGTTGGAGGGCTGCAGG - Intergenic
1040313635 8:46249601-46249623 GGGTGGTGTGGGTGGGCTGCAGG + Intergenic
1041255373 8:55975950-55975972 TGGTGGTGCTTTTGGCCTGCAGG + Intronic
1042307557 8:67347093-67347115 TGGTGGTGCTTGAGGGTGGAGGG + Intergenic
1042339281 8:67662009-67662031 AGATGGTGTTGCTGGGCTGAAGG - Intronic
1042562463 8:70083019-70083041 TGGTGGCGGGGGTGGGGTGAGGG - Intergenic
1042826602 8:72986042-72986064 TGGTGGTGGGGGTGGGGTCATGG + Intergenic
1042848714 8:73194059-73194081 TGGTGGTGGTGGTGTGGTGGTGG - Intergenic
1042851960 8:73225790-73225812 TGGTGGTGGTGGAGGGCTGGGGG - Intergenic
1043887747 8:85622044-85622066 TAGTGGTGCTGGTGGGGAGGTGG + Intergenic
1045994963 8:108351936-108351958 TGTTGGTGGTGGTGGCCAGAGGG + Intronic
1046046569 8:108972473-108972495 TGGTGGTGGTGGTGGTGTCAGGG + Intergenic
1046454538 8:114440901-114440923 GGGAGGGGCTGGTGGGCAGAAGG - Intergenic
1046820937 8:118633656-118633678 TGGTGGTTCTGGGAGGCTGAGGG - Intergenic
1047289022 8:123513046-123513068 TGGTGCTGAGGGTGGGCTGGGGG - Intronic
1047460839 8:125063868-125063890 TGGTGGTGCTTATGTGCTGTTGG - Intronic
1047761280 8:127956287-127956309 TGATGGTGCTGGATGGATGAGGG - Intergenic
1047862580 8:128984635-128984657 TGGTGGTGGTGGTGGTGGGAGGG - Intergenic
1048031807 8:130640206-130640228 AGGTGGGGCTGGTGGGCAGGAGG + Intergenic
1048442328 8:134469174-134469196 GGGTGGTGTTGGGGGGCTGATGG + Intergenic
1049417375 8:142501408-142501430 TGGTGGTGATGATGGGGTGGTGG + Intronic
1049417389 8:142501471-142501493 TGGTGGTGATGATGGGGTGGTGG + Intronic
1049417428 8:142501641-142501663 TGGTGGTGATGATGGGGTGGTGG + Intronic
1049417471 8:142501814-142501836 TGGTGGTGATGATGGGGTGGTGG + Intronic
1049417544 8:142502143-142502165 TGGTGGTGATGATGGGGTGGTGG + Intronic
1049417565 8:142502252-142502274 TGGTGGTGATGATGGGGTGGCGG + Intronic
1049421829 8:142520219-142520241 TGGTGGTGATGGAGTGATGATGG + Intronic
1049695397 8:143981982-143982004 TGGTGATGGTGATGGGGTGATGG + Intronic
1049792786 8:144479673-144479695 TGGGGGTGCTGGTAGTCTGTGGG - Intronic
1052748761 9:32467447-32467469 TGGTGGTGCTGGTGGGCTGAAGG - Intronic
1052840426 9:33288321-33288343 GGGTGGTGTTGGGGGGCTGGGGG + Intergenic
1053365450 9:37519460-37519482 TGTTGCTGTTGGTGGGCAGAGGG - Intronic
1053739651 9:41125484-41125506 TGGTGGTGCTATGGGGCTGACGG + Intergenic
1054688701 9:68305836-68305858 TGGTGGTGCTATGGGGCTGACGG - Intergenic
1055965142 9:81858913-81858935 GGATGGTGCTGGTGTGCTCAGGG - Intergenic
1056017630 9:82407465-82407487 TGGTTTTGATGATGGGCTGAGGG + Intergenic
1056045887 9:82715385-82715407 TGGTGGTGGTGGTGGGGGGTGGG + Intergenic
1056716325 9:89033523-89033545 TGGAGGTGATGGGGTGCTGAGGG - Intronic
1058127281 9:101209484-101209506 TGGAGGTGCTGATGGACTGAAGG - Intronic
1058128717 9:101225727-101225749 TGGGGGTGGTGGTGGGGTGGGGG - Intronic
1058547792 9:106079534-106079556 TTCTGGTGGTGGTGGGCTGGAGG + Intergenic
1058609338 9:106757774-106757796 TGGTGGTGGTGGGGGGGTGGTGG + Intergenic
1058614220 9:106808544-106808566 AGGTGATGCTGGTGATCTGATGG - Intergenic
1058620404 9:106877174-106877196 TGGTGGTGGTGGTGGTGTGGTGG + Intronic
1058620405 9:106877177-106877199 TGGTGGTGGTGGTGTGGTGGTGG + Intronic
1059328599 9:113520260-113520282 TGCTGGTGCTGGTGAGATGGGGG + Intronic
1059436224 9:114278148-114278170 TGGTGGTGATGGTGAGTGGATGG + Intronic
1059768076 9:117402783-117402805 GGGTGGTGGTGGTGGTGTGATGG + Intronic
1059768077 9:117402786-117402808 TGGTGGTGGTGGTGTGATGGAGG + Intronic
1060014170 9:120071945-120071967 TGGTGGGGCTAGTGTGCTGTTGG - Intergenic
1060158574 9:121338362-121338384 TGGTGGTGGTGGTGTGTGGATGG + Intergenic
1060695617 9:125706913-125706935 TGGGCAAGCTGGTGGGCTGACGG + Intronic
1060774945 9:126366150-126366172 TGGAGGAGCTGGTGAGATGAAGG - Intronic
1061656642 9:132096949-132096971 TGGCAGTGCTGGTGAGCAGAGGG - Intergenic
1061674566 9:132208457-132208479 TGGCGGTGCTGGAGGCCTGCAGG + Intronic
1061844977 9:133382545-133382567 TGGTGGTGATGGTGTGATGATGG + Intronic
1061844992 9:133382641-133382663 TGATGGTGGTGGTGGTGTGATGG + Intronic
1061845017 9:133382836-133382858 TGGTGGTGATGGTGTGATGATGG + Intronic
1061845062 9:133383106-133383128 TGGTGGTGATGGTGTGATGATGG + Intronic
1061845079 9:133383247-133383269 TGGTGGTGGTGTTGGAGTGATGG + Intronic
1061845106 9:133383442-133383464 TGGTGGTGGTGATGGAGTGATGG + Intronic
1061845127 9:133383590-133383612 TGGTGGTGGTGATGGAGTGATGG + Intronic
1061845133 9:133383622-133383644 TAGTGGTGGTGGTGTGATGATGG + Intronic
1061954437 9:133954272-133954294 AGCAGGTGCTGGTGGGCGGATGG - Intronic
1062026394 9:134342626-134342648 TGGTGGGGCTGCGGGGCTGCGGG + Intronic
1062031791 9:134365146-134365168 GGCTGTTGCTGGAGGGCTGATGG + Intronic
1062564359 9:137157345-137157367 TGGTGGTGCTGGGGGTGTGGGGG - Intronic
1062617239 9:137403414-137403436 TGCTGCTGCTGCTGGGCTGGGGG - Intronic
1062717940 9:138020557-138020579 TGGTGGTGCTGGCCGAGTGAGGG + Intronic
1203758399 Un_GL000218v1:157807-157829 TGGTGGGACTGCTGGGCTTAAGG + Intergenic
1203461400 Un_GL000220v1:43295-43317 TGCTGGTGTTGTGGGGCTGATGG + Intergenic
1203717758 Un_KI270742v1:170481-170503 TGGTTGTACTGCTGGGCTTAAGG + Intergenic
1203651979 Un_KI270751v1:134068-134090 TGGTTGTACTGCTGGGCTTAAGG + Intergenic
1185608692 X:1381419-1381441 TGCTGGCGCTGGTGGGCGGCTGG + Intronic
1185854751 X:3523771-3523793 TGGTGGTGCAGTGGGGATGAAGG - Intergenic
1185872418 X:3674902-3674924 TCATGGTGCACGTGGGCTGATGG + Intronic
1186246199 X:7619323-7619345 TGCTGCTGCTGGTGGTCTGGAGG - Intergenic
1186474877 X:9849451-9849473 TGGGGGTGCTGGTGGCCTTGTGG + Intronic
1186850096 X:13571103-13571125 TGGTGGTGGTGGTGGGGGGTGGG - Intronic
1187688438 X:21839754-21839776 TGGTGGTGGTGGTGGGTGGCTGG + Exonic
1188743795 X:33817254-33817276 TGGTGGTCCTGGGGGACAGAGGG + Intergenic
1189364553 X:40378340-40378362 TGGAGGTGCTGGTAGGATGCTGG - Intergenic
1189420745 X:40855618-40855640 TGGTGGTGCTGGTGGTAGAAGGG + Intergenic
1189585840 X:42460971-42460993 TGGAGGTGCTGTGGGGCTGCAGG - Intergenic
1189812195 X:44791034-44791056 TGGTGGTAGTAGGGGGCTGAGGG - Intergenic
1189897823 X:45673742-45673764 TGGTGGTGGTGGTGTGTTGGTGG - Intergenic
1190119627 X:47649821-47649843 TGGTGGTGGTGGTGGGGGGGGGG + Intronic
1190298091 X:49040218-49040240 TGGGTGTGCAGGTGGGCTGGGGG + Intronic
1190916259 X:54813247-54813269 TGGTGGAGCGGGTGGGGTGCTGG + Intronic
1190928131 X:54926712-54926734 TGGTGGAGCGGGTGGGGTGCTGG + Intronic
1191197207 X:57737065-57737087 TGGTGGTGTTGGTGGCCACAGGG + Intergenic
1192194891 X:69021509-69021531 TGGGGGTGGTGGTGGGATGAGGG + Intergenic
1192232739 X:69277302-69277324 TGGTGGTGGTGGTGGGGAGGTGG + Intergenic
1192433006 X:71125329-71125351 TGATGGTGCTGCTGGGATGCAGG + Exonic
1192491402 X:71579479-71579501 TGGTGGTGCTGGTGGGCGTGGGG + Intronic
1192504156 X:71670714-71670736 TGGTGGTGGGGGTGGACTGCAGG + Intergenic
1192509812 X:71715168-71715190 TGGGGGCGGTGGTGGGCTGCAGG - Intronic
1192516885 X:71766385-71766407 TGGGGGCGGTGGTGGGCTGCAGG + Intronic
1193917166 X:87379433-87379455 TGATGGTGGTGGTGGCCAGAAGG + Intergenic
1194807568 X:98348074-98348096 GGGTGGTGGTGGTGGGCAGGAGG + Intergenic
1194841925 X:98753776-98753798 TGGTGGTGGTGGTGGCCACAGGG - Intergenic
1194855391 X:98921477-98921499 TGGTGGTGATGGGGGGGTGGTGG - Intergenic
1195312329 X:103643640-103643662 TGGTGGTGCTGGTGGCCACTGGG + Intergenic
1195940885 X:110167245-110167267 TTTTCCTGCTGGTGGGCTGAGGG - Intronic
1197311641 X:124912519-124912541 TGGTGTTGCAGGTGGGCTCTGGG - Intronic
1198890672 X:141392241-141392263 TTGGGGTGCTGGTGGGCACAGGG + Intergenic
1200791487 Y:7303779-7303801 TCATGGTGCACGTGGGCTGATGG - Intergenic