ID: 1052748762

View in Genome Browser
Species Human (GRCh38)
Location 9:32467454-32467476
Sequence CCTTTCATGGTGGTGCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052748762_1052748768 -7 Left 1052748762 9:32467454-32467476 CCCACCAGCACCACCATGAAAGG 0: 1
1: 0
2: 4
3: 22
4: 252
Right 1052748768 9:32467470-32467492 TGAAAGGTTTACATGTTGACTGG No data
1052748762_1052748769 14 Left 1052748762 9:32467454-32467476 CCCACCAGCACCACCATGAAAGG 0: 1
1: 0
2: 4
3: 22
4: 252
Right 1052748769 9:32467491-32467513 GGCAAAGCTTCAATCCAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052748762 Original CRISPR CCTTTCATGGTGGTGCTGGT GGG (reversed) Intronic
900822412 1:4899696-4899718 TCTTACATGGGGGTGCGGGTAGG - Intergenic
900832483 1:4975143-4975165 TCACTCATTGTGGTGCTGGTGGG + Intergenic
901000530 1:6146786-6146808 CCCTTCATGGTGGGGCTGCCGGG - Exonic
901133793 1:6979832-6979854 CCTCTCATGGTGGTGTAGCTGGG + Intronic
901660935 1:10797234-10797256 CCTTACATGGAGGGGCTGGGGGG + Intergenic
903379559 1:22887262-22887284 CCCTTCCTGGTGGTGGTGGCTGG - Intronic
905957971 1:42015129-42015151 GCTTTGGTGGTGGTGCTGGTTGG - Intronic
906675899 1:47693480-47693502 CCTTTCATGGTGGATTTGGCCGG + Intergenic
906818616 1:48905205-48905227 TCTTTCATAGAGGGGCTGGTAGG - Intronic
907767052 1:57422839-57422861 TGTTTTTTGGTGGTGCTGGTGGG - Intronic
907900936 1:58740965-58740987 GCTTTGGTGGTGGTGGTGGTTGG + Intergenic
911993101 1:104727561-104727583 TCTTTGTTGGTGGTGGTGGTAGG - Intergenic
913659429 1:120993442-120993464 CCACTCCTGGTGGTTCTGGTTGG + Intergenic
914010791 1:143776569-143776591 CCACTCCTGGTGGTTCTGGTTGG + Intergenic
914167037 1:145184546-145184568 CCACTCCTGGTGGTTCTGGTTGG - Intergenic
914649413 1:149685226-149685248 CCACTCCTGGTGGTTCTGGTTGG + Intergenic
916214687 1:162384877-162384899 TCTTTTATGCTGATGCTGGTGGG + Intronic
917970112 1:180200861-180200883 CTTTATATGGTGGTGCTGCTGGG + Exonic
920126759 1:203699746-203699768 CCTTAAATGGGGGTGGTGGTGGG - Intronic
923270587 1:232352014-232352036 TTCTTCAGGGTGGTGCTGGTGGG + Intergenic
924847873 1:247790969-247790991 CCACTCCTGGTGGTACTGGTTGG - Intergenic
1064121279 10:12622207-12622229 CCTTTGCTGCTGGTGGTGGTGGG + Intronic
1065784024 10:29196413-29196435 CCTTTCATGTTGGTGGTGTGGGG - Intergenic
1067698460 10:48552207-48552229 CCCCTCTTGGGGGTGCTGGTTGG + Intronic
1069720262 10:70545167-70545189 CCTTGCAGGGTGGTGGGGGTAGG + Intronic
1069948887 10:72006013-72006035 CCTTTCAAGGTGGGGTGGGTGGG + Intronic
1070318400 10:75335748-75335770 CCTTCCATGGTGGTGTGGGTGGG + Intergenic
1071517128 10:86305626-86305648 CCTATTATGGTGGTGGTGGGGGG - Intronic
1073888977 10:108075253-108075275 CCATTAATTGTGGTCCTGGTAGG - Intergenic
1074008681 10:109455489-109455511 CCTTTCATGGTGTTTTAGGTTGG - Intergenic
1074404155 10:113166032-113166054 CCTTTCAAGGTGGGGGTGGGGGG - Exonic
1074935075 10:118170161-118170183 CCTTGCAGGGTGTTGCTGGGAGG + Intergenic
1077601417 11:3577531-3577553 CCATTCGTGGTGGTGGTGGGGGG - Intergenic
1077798469 11:5515490-5515512 CCTGTGATGGTGGTGGAGGTGGG + Exonic
1079101109 11:17543064-17543086 CCTTTGCTGGTGGTGTAGGTGGG - Intronic
1080610672 11:33901095-33901117 CATTTCATGGTGGTGGTGTAAGG + Intergenic
1080936591 11:36870105-36870127 CTTTTTGTGGTGGTGGTGGTTGG - Intergenic
1083915277 11:65739030-65739052 CCACTCCTGGTGGTACTGGTTGG + Intergenic
1084815445 11:71643161-71643183 CCATTCGTGGTGCTGGTGGTGGG + Intergenic
1085645235 11:78218384-78218406 GCTTTCAAGGTGGGGCTGGCGGG + Exonic
1085793091 11:79512944-79512966 CCCTACATGGTGGTGCCTGTGGG - Intergenic
1085822573 11:79808386-79808408 CCACCCTTGGTGGTGCTGGTAGG + Intergenic
1086732612 11:90269097-90269119 CCTGTCATTGTGATGCTGGCTGG + Intergenic
1087539082 11:99491864-99491886 CCTTGGATGGTGGTGCAAGTAGG + Intronic
1088500675 11:110479407-110479429 CTATTGATGGTGGTGCTGGTGGG + Intergenic
1088729037 11:112664563-112664585 CCTTTTTTCCTGGTGCTGGTGGG - Intergenic
1089689329 11:120177305-120177327 CCTTTCATCCTGGTGATGTTAGG - Intronic
1089838644 11:121394142-121394164 CCTTCCATGGTGGGGCAGGGCGG + Intergenic
1090184446 11:124727352-124727374 CCTTTTATGGTGGTGGAGGAAGG - Intergenic
1090235282 11:125142357-125142379 GCTTGCAGGGTGGTGCTGGCGGG + Intergenic
1092297291 12:7210485-7210507 CCTTTCTTGGTGCTGCTTTTTGG + Intronic
1092428832 12:8393868-8393890 CCATTCATGGTGGTGGTGGGGGG - Intergenic
1092779076 12:11968697-11968719 CCTCCCATGGTGGTGGAGGTGGG + Intergenic
1098550384 12:71755184-71755206 TCGTTCAAGGTGGTGCTGCTGGG + Exonic
1101409216 12:104455486-104455508 CCTTTCTTAGTGATGATGGTGGG + Intronic
1101579834 12:106032706-106032728 CATTTGGTGGTGGTGGTGGTGGG - Intergenic
1103493847 12:121345566-121345588 CCTTTCTTGGGGGTCCTGGGGGG - Intronic
1103539241 12:121654466-121654488 GCTTTCCTGGTGGTGTTGGGGGG - Intronic
1107561804 13:41563623-41563645 TCTTGCATGGTGGTGCACGTTGG - Intergenic
1107715959 13:43199643-43199665 CATTACCTGGTGGTGGTGGTGGG + Intergenic
1108067683 13:46595288-46595310 CCTTTCCTGATGGTGCTGCATGG + Intronic
1108975901 13:56442772-56442794 CCTTTCATGGTGGGGAGTGTGGG + Intergenic
1111431248 13:88150714-88150736 CCAGTCCTGGTGGTACTGGTTGG + Intergenic
1111801986 13:92992623-92992645 CCTTTCTAAGTGGTGCAGGTTGG + Intergenic
1112860806 13:103828074-103828096 CCTGTCATTGTGATGCTAGTTGG + Intergenic
1114462686 14:22897729-22897751 TCTTCCATGGTGGTGCTGAGAGG + Intergenic
1114631009 14:24159719-24159741 GCTTTCCCAGTGGTGCTGGTGGG - Intronic
1117377745 14:55130734-55130756 TTTTTCGTGGTGGTGGTGGTGGG + Intronic
1117751260 14:58925843-58925865 CCTGTCATCGTGATGCTGGTTGG - Intergenic
1120327726 14:83051477-83051499 CCACTCCTGGTGGTACTGGTTGG - Intergenic
1120448488 14:84633557-84633579 CCTTTTATGGTAATGCTGGCTGG - Intergenic
1122023933 14:98860884-98860906 ATTTTCTTGGTGGTGGTGGTGGG - Intergenic
1122054004 14:99080031-99080053 CCTTTCCTGGTGTGTCTGGTGGG - Intergenic
1123036323 14:105473426-105473448 GCTTTCATGGTGGTCCTGGCTGG - Exonic
1124087835 15:26568403-26568425 TCTGTCATGGTGGTGGTGGTAGG - Intronic
1125770069 15:42159360-42159382 TCTTTGATGGTGGTGAGGGTGGG - Exonic
1126873289 15:53011619-53011641 CCTATGATGGTGGTGATGGTGGG + Intergenic
1127211866 15:56781811-56781833 ACTGTCATGGTGCTGGTGGTGGG - Intronic
1127815978 15:62609040-62609062 CTTGTGATGGTGGTGGTGGTGGG + Intronic
1130548563 15:84874241-84874263 CCTTTCCTGGTAGTGGAGGTAGG + Intergenic
1130666451 15:85873702-85873724 CCCTTCTTGGTGGTGTAGGTTGG + Intergenic
1131027191 15:89153508-89153530 CTTTCCATGTTGGTCCTGGTAGG - Intronic
1133880521 16:9777402-9777424 CTTTTGATGGTGGTGGTGATAGG + Intronic
1135335617 16:21599253-21599275 CCCTCCAAGGTGGTGCTGGAAGG - Intronic
1138594635 16:58023284-58023306 CCTTTGATGGTGGGTCGGGTGGG + Intergenic
1142525638 17:538309-538331 CCTTTCACAGTGGAGCTGGACGG + Intronic
1142621858 17:1170310-1170332 CCCTTCACAGCGGTGCTGGTGGG - Intronic
1143107349 17:4536344-4536366 CCTTTCGTCGTGGTCCTGGGCGG + Exonic
1144099920 17:11934139-11934161 GCTTCCCTGGTGGTGCAGGTCGG - Intronic
1146022899 17:29293799-29293821 CGTTTCCTGGTGCTGCTGGAGGG + Exonic
1146707066 17:35008571-35008593 CCGTGCATGGTGGTGCATGTGGG - Exonic
1147965160 17:44190724-44190746 CCTGTCTTTGTGGTGCTGTTGGG + Exonic
1147992859 17:44345625-44345647 CCTCTCCTGGTGGTGGTGGGTGG + Intronic
1152093689 17:78260555-78260577 CCATGTACGGTGGTGCTGGTGGG + Intergenic
1152290679 17:79438317-79438339 ACTATCATGGAGGAGCTGGTTGG - Intronic
1153672401 18:7424405-7424427 CCATTAATGGGGGTGCTGGGTGG + Intergenic
1154017100 18:10628312-10628334 CCTTGCTGGGTGGTACTGGTTGG - Intergenic
1154187758 18:12201291-12201313 CCTTGCTGGGTGGTACTGGTTGG + Intergenic
1156129841 18:33958171-33958193 ACTTTCATGTTGTTGCTTGTTGG - Intronic
1156495740 18:37524266-37524288 CCTGTGATGTTGGTGCTGGCGGG + Intronic
1157218892 18:45810379-45810401 CCTTTCCTGGTTGTGGTGTTAGG - Intergenic
1158521912 18:58178206-58178228 TCTTTCATATTGCTGCTGGTCGG + Intronic
1158641621 18:59208378-59208400 TCTTTCTTGGTGGTGATGATAGG + Intergenic
1159612579 18:70542765-70542787 CCTTTCTTGGTTTTGGTGGTAGG + Intergenic
1160200385 18:76790996-76791018 CATGTCATGGAGGTGCTGATGGG + Intergenic
1160350198 18:78171860-78171882 CCTTTCATGGCGGGGGTGGGGGG + Intergenic
1161096061 19:2391708-2391730 CCTTTCAGGGGGGTCCTGATGGG - Intronic
1163415352 19:17183241-17183263 CCTTTCAGGATCATGCTGGTGGG - Intronic
1164599968 19:29554527-29554549 CCTGTCATCATGATGCTGGTTGG - Intronic
1165247830 19:34507735-34507757 TTTTTCATGGTGGTGGTGATGGG + Exonic
1166534062 19:43560947-43560969 GCTTTCGTGGAGGTGCTGGTGGG - Exonic
1168217991 19:54940286-54940308 CCTTACACGGTGGTGCTGCACGG - Exonic
926180590 2:10639516-10639538 CATTGCTTGGTGGTGGTGGTTGG - Intronic
928839517 2:35588113-35588135 CCATTCATGGTGGTACTTCTTGG + Intergenic
929153665 2:38770723-38770745 CTTTTTTTGGTGGTGGTGGTGGG + Intronic
931343509 2:61425612-61425634 CCCTCCATGGTGAGGCTGGTGGG - Intronic
931510662 2:62989239-62989261 CCTTTGGTGGTGGTTATGGTGGG - Intronic
931547928 2:63409153-63409175 CCTGTCCTGGTGGAGGTGGTGGG - Intronic
931559514 2:63544283-63544305 GGTATCATGGTGGTGATGGTAGG - Intronic
933809225 2:86022101-86022123 CCTCTCATGGAGCTGCTTGTAGG + Exonic
937626657 2:124051619-124051641 GCATTGATGGTGGTGGTGGTGGG + Intronic
938788790 2:134658385-134658407 CCTTTCTACGTAGTGCTGGTGGG - Intronic
939247089 2:139639255-139639277 CCTTTTATGATGGCTCTGGTTGG - Intergenic
939248041 2:139650237-139650259 CCTGTCATCATGATGCTGGTTGG - Intergenic
942337202 2:174901293-174901315 CCTTGCATGGACATGCTGGTCGG + Intronic
942905389 2:181174154-181174176 CCTTCCCTAGTGATGCTGGTAGG - Intergenic
943770587 2:191712250-191712272 GCTTTGATGGAGGTGATGGTAGG + Intergenic
945000391 2:205344100-205344122 CTTTTAATGGTGTTGCTGCTGGG + Intronic
945464044 2:210145981-210146003 TCCTTCTTGGTGGTGGTGGTGGG + Intronic
945772889 2:214067082-214067104 GCTTTCCAGGTGGTGCTGTTTGG + Intronic
947728644 2:232416343-232416365 CAGTACATGGTGGTGATGGTCGG - Intergenic
1170983211 20:21235221-21235243 CATTTCATTGTGATGGTGGTGGG + Intronic
1171316697 20:24201831-24201853 CCTTGCGTGGAGGTGCTGCTGGG - Intergenic
1172355188 20:34275026-34275048 CCCTTCATGGTGCAGCTGGGAGG - Intergenic
1172355205 20:34275083-34275105 CCCTTCATGGTGCAGCTGGGAGG + Intergenic
1172449792 20:35013875-35013897 TCTGCCATGGTGCTGCTGGTGGG + Intronic
1173454455 20:43191254-43191276 ACGGTCATGGTGGTGGTGGTGGG - Intergenic
1174417717 20:50378546-50378568 CCTTTGCTGGTGGCGCTGGTGGG + Intergenic
1175308380 20:57993847-57993869 CATTTCATGGTGATCCAGGTAGG + Intergenic
1177546737 21:22568283-22568305 GTTTTCATGGTTGTGCTGGTAGG + Intergenic
1177690005 21:24493644-24493666 CGTTTCATGGGGGTACTGGTGGG - Intergenic
1178801066 21:35796213-35796235 GCGTTCGTGGTGATGCTGGTGGG + Intronic
1179971364 21:44838009-44838031 CCCTTTATGGTGGTGCTGCGAGG - Intergenic
1180102567 21:45595974-45595996 CCTTTCATGCTGGCCGTGGTGGG + Intergenic
1180709383 22:17829478-17829500 CCTTTCTTTATGGTGCTGGGTGG + Intronic
1181444165 22:22956181-22956203 CCTTTCGTGGGGGTGCTGGTGGG - Intergenic
1181593462 22:23898253-23898275 CCCTTCAGTGTGGGGCTGGTGGG - Intronic
1182164811 22:28162590-28162612 CCTGTCATCGTGGTGCTGTAAGG - Intronic
1182963980 22:34504392-34504414 CCACTCCCGGTGGTGCTGGTTGG - Intergenic
1183104544 22:35606699-35606721 TCCTTGATGCTGGTGCTGGTGGG + Intergenic
1183120826 22:35728844-35728866 CCTTTCTTGCTGGTGCTGGTGGG - Exonic
1183463466 22:37967109-37967131 CCTGTGATGGTGGAGCTGGAGGG + Exonic
1183485679 22:38086553-38086575 CCTTTCATGCAGGTGCGGGGAGG - Intronic
1184200526 22:42965729-42965751 CCTTTCATCGCGGTGCTAGTGGG - Intronic
1184665850 22:45988708-45988730 CCCATCAGGGCGGTGCTGGTCGG - Intergenic
949642926 3:6060015-6060037 CCTTTCCTCATTGTGCTGGTAGG - Intergenic
950750224 3:15122614-15122636 CCATTCATGGTGGTGGTGGTGGG + Intergenic
952466625 3:33595041-33595063 CCTTTCATTGTAGTGTTGGGTGG - Intronic
952493726 3:33897405-33897427 CATTTCATGGTGGGGCTACTTGG + Intergenic
952825255 3:37519311-37519333 TCTATCATGGTGATGCCGGTGGG + Exonic
958640066 3:96794640-96794662 CCAGTCATGGTGGTGGTGGCAGG + Intergenic
959619247 3:108382158-108382180 CATTACATGGGGTTGCTGGTGGG + Intronic
961281804 3:125770189-125770211 CCATTCGTGGTGGTGGTGGGAGG + Intergenic
961659760 3:128462500-128462522 CCATGCACGGTGGTGGTGGTGGG + Exonic
961754778 3:129121416-129121438 CTGTTCAAGCTGGTGCTGGTGGG - Exonic
961909784 3:130302531-130302553 CCATTCCTGGTGGTACTGGTTGG - Intergenic
963590592 3:147252913-147252935 CTTTTCATGGGTGTCCTGGTGGG - Intergenic
966219493 3:177536198-177536220 CCTGTGATGGTGGTGGTGCTGGG + Intergenic
966806948 3:183815290-183815312 CCCTTCCTGGCAGTGCTGGTGGG - Intergenic
968187988 3:196646424-196646446 CCTTGCATGCTGGTGGTGGCTGG - Intronic
968904624 4:3445623-3445645 CCTTTCAGGGAGGTGCAGGGAGG + Intronic
969718805 4:8881792-8881814 ATTTCCATGGTGGTGGTGGTGGG + Intergenic
969738093 4:9004454-9004476 CCATTCGTGGTGCTGGTGGTGGG + Intergenic
969797283 4:9535998-9536020 CCATTCGTGGTGCTGGTGGTGGG + Intergenic
970107184 4:12597571-12597593 CCTGTCATCGTGATGCTGGTTGG - Intergenic
970546170 4:17132722-17132744 CTTTTCAGGATGGTGATGGTTGG + Intergenic
974726229 4:65802201-65802223 CCCAACATGGTGGTGCTGGCAGG + Intergenic
974814464 4:66987474-66987496 CCTGTCATCATGGTGCTGGCTGG + Intergenic
975805015 4:78103132-78103154 CCTTTCATGGTGTTGAGGCTGGG - Intronic
977489550 4:97695003-97695025 CCTTTCATGGTTTTGCTATTAGG - Intronic
977877661 4:102167881-102167903 TCTGTCATGATTGTGCTGGTGGG + Intergenic
978372068 4:108039027-108039049 ACTTTCAGAGAGGTGCTGGTCGG + Intergenic
979436524 4:120699516-120699538 AATTCCATGTTGGTGCTGGTTGG - Intronic
983475582 4:168208236-168208258 CCTTGCCTGTTGGTGCTGGCAGG + Intergenic
985494183 5:195448-195470 CTTTTGGTGGTGGTGGTGGTGGG - Intergenic
986063250 5:4211709-4211731 CATTTCATGGTGATCCTGTTAGG + Intergenic
986284723 5:6350896-6350918 CCTCTCTAGGTGCTGCTGGTGGG - Intergenic
986796745 5:11219977-11219999 CCTTTCAAGATGGAGCTGTTTGG - Intronic
988832528 5:35001902-35001924 CCTTCCTTCGTGGAGCTGGTGGG - Intronic
989461696 5:41706991-41707013 CCTGTCATGGTGGTATTGGCTGG + Intergenic
992844650 5:80734364-80734386 AATTACATGGTGGTGATGGTTGG + Intronic
994160526 5:96551526-96551548 CCTTTCATTGTGATGCTAGCTGG - Intronic
998422879 5:142003654-142003676 CCCTTGCTGGTGGTGCAGGTTGG - Intronic
999342163 5:150781630-150781652 TCTTTGGTGGTGGTGGTGGTGGG + Intronic
1003858943 6:10304297-10304319 GTTCTCATGGTGCTGCTGGTAGG - Intergenic
1004141978 6:13026604-13026626 CTGTTCATGGTGGTGGTGGGTGG + Intronic
1006020343 6:31114256-31114278 CCTATCAGGGTGGTGCTGTCTGG - Intergenic
1006826297 6:36938729-36938751 TCTTGCATGGTGGTGCTGACAGG + Intergenic
1006985824 6:38174982-38175004 CCTTTATTGGTGCTGCCGGTTGG + Exonic
1007258303 6:40544019-40544041 CATCTCAGGGTGGTGCTGGTTGG - Intronic
1010167751 6:72937400-72937422 CCTTTAAATGTGGTTCTGGTGGG - Intronic
1011522864 6:88228835-88228857 CCCTTCTTGGTGCTGCTGTTGGG - Intergenic
1013743520 6:113317893-113317915 CCTTTCATTGAGGGGCAGGTGGG - Intergenic
1014221245 6:118800813-118800835 CCTTTCACGGTGGTGCTCCAGGG + Intergenic
1017713523 6:157190900-157190922 CCTGTCATGGGGGTGGTGGTGGG + Intronic
1017888983 6:158624127-158624149 CCTGTCACTGTGGTTCTGGTCGG + Intronic
1018706637 6:166468261-166468283 CATTTCTTGGAGGTCCTGGTTGG + Intronic
1019087688 6:169496641-169496663 CTTGTCATAGTGGTGATGGTTGG - Intronic
1019277481 7:183331-183353 CCTTTGGTGGTGGGGTTGGTGGG + Intergenic
1021390830 7:20090567-20090589 CCTGTCATGATGATGCTGGCTGG - Intergenic
1024293749 7:47826700-47826722 CCCATCATGGTGGTGCTGGATGG - Intronic
1025252927 7:57364003-57364025 CCTTTGCTGGTGGCACTGGTGGG - Intergenic
1026230912 7:68483301-68483323 CCTTCCATGGTGGTTGTGGAAGG - Intergenic
1027178405 7:75919875-75919897 CCTTTCATTGGAGTGCTGGAGGG + Intronic
1027658278 7:80958628-80958650 CCTTTCCTCGTGGTACTCGTTGG - Intergenic
1028518995 7:91708016-91708038 GCTATCATGGTGGTAGTGGTGGG - Intronic
1029074533 7:97925542-97925564 CCATTCATGGTGGTGGTGGTGGG - Intergenic
1029510837 7:100993996-100994018 CCTGGCGTGGTGGTGCTGGCAGG - Exonic
1029511330 7:100997245-100997267 CCTGGCGTGGTGGTGCTGGCAGG - Exonic
1029511556 7:100998667-100998689 CCTGGCGTGGTGGTGCTGGCAGG - Exonic
1029512054 7:101001916-101001938 CCTGGCGTGGTGGTGCTGGCAGG - Exonic
1029512259 7:101003257-101003279 CCTGGCATGGTGGTACTGCTAGG - Exonic
1029976061 7:104834902-104834924 CCTTTTATTTTGGTGCAGGTGGG + Intronic
1034028284 7:147732185-147732207 CCTGTCATGGGGGTGGTGGGGGG - Intronic
1035448818 7:158961405-158961427 CCTTTCCTGGAGGAGCTGCTTGG - Intergenic
1035458052 7:159022432-159022454 TCTGTCCTGGTGGTGCTGGGAGG + Intergenic
1036243177 8:7095742-7095764 TCATTCATGGTGGTGGTGGTGGG + Intergenic
1036257623 8:7218316-7218338 CCATTCGTGGTGGTGGTGGGGGG - Intergenic
1036258875 8:7225315-7225337 CCATTCGTGGTGCTGGTGGTGGG - Intergenic
1036307745 8:7614195-7614217 CCATTCGTGGTGCTGGTGGTGGG + Intergenic
1036309675 8:7676912-7676934 CCATTCGTGGTGGTGGTGGGGGG - Intergenic
1036310930 8:7683911-7683933 CCATTCGTGGTGCTGGTGGTGGG - Intergenic
1036358599 8:8062196-8062218 CCATTCGTGGTGCTGGTGGTGGG + Intergenic
1036359863 8:8069207-8069229 CCATTCGTGGTGGTGGTGGGGGG + Intergenic
1036891094 8:12597763-12597785 CCATTCGTGGTGGTGGTGGGGGG - Intergenic
1036892360 8:12604756-12604778 CCATTCGTGGTGCTGGTGGTGGG - Intergenic
1036899904 8:12662732-12662754 CCATTCGTGGTGCTGGTGGTGGG - Intergenic
1039415096 8:37386614-37386636 CCTTTCATGGTGGCCCAGGAGGG - Intergenic
1039429735 8:37516495-37516517 CCTTGCATGGTGCCGGTGGTGGG - Intergenic
1039888871 8:41671252-41671274 CCTTTGAAGGAGGGGCTGGTGGG - Intronic
1040430612 8:47338148-47338170 CCTTTCCTGGTGGTGGTGTGTGG + Intronic
1041904197 8:63013491-63013513 TCTTTCCTGCTGGTGGTGGTGGG + Intergenic
1043180403 8:77081744-77081766 CCTTAGTTGGTGGTGGTGGTTGG + Intergenic
1043600233 8:81928698-81928720 CCCTCCATGCTGGTGCTGGCTGG - Intergenic
1045978013 8:108151169-108151191 CCTGTCATCATGGTGCTGGTGGG - Intergenic
1048943475 8:139423366-139423388 GCTTTCAAAGTGGTGCTGGAAGG - Intergenic
1049786793 8:144454743-144454765 CCCTGCCTGGTGGTGCTGGGAGG + Intronic
1049873006 8:144995621-144995643 GCCTTGATGGTGCTGCTGGTAGG - Intergenic
1050992755 9:12173549-12173571 CCACTCCTGGTGGTACTGGTTGG + Intergenic
1052336173 9:27322660-27322682 CCTGTCATTGTGATGCTGGCTGG + Intergenic
1052748762 9:32467454-32467476 CCTTTCATGGTGGTGCTGGTGGG - Intronic
1053005391 9:34600845-34600867 TCCTTCTTGGTGGTGGTGGTGGG + Intergenic
1053125487 9:35577353-35577375 CCACTCCTGGTGGTACTGGTTGG - Intergenic
1053160590 9:35810924-35810946 TCTTTCTGGGTGGTGCTGGAGGG + Exonic
1058012705 9:99996128-99996150 CCCAACATGGAGGTGCTGGTAGG + Intronic
1060403457 9:123361400-123361422 CCTTTCCTGGGGGAGCTGGAAGG + Intronic
1060673348 9:125490116-125490138 CCTATGGTGGTGGTGGTGGTGGG + Intronic
1061750104 9:132771202-132771224 CCTTTCCTGGTCTTGCTGGAAGG + Intronic
1061889650 9:133611315-133611337 TCTTTCTAGGTGGGGCTGGTTGG - Intergenic
1062512401 9:136914061-136914083 CCCTTCATGGTGATGCTGGCAGG + Intronic
1187163509 X:16785323-16785345 CCGGGCATGGTGGTGGTGGTGGG - Intergenic
1187436248 X:19272559-19272581 ACTCTCATGCTGCTGCTGGTGGG + Intergenic
1189009386 X:37031021-37031043 CTTTTCAGGGTGCTGCTGGGTGG + Intergenic
1189320597 X:40084710-40084732 CCTTCGGTGGTGGTGGTGGTGGG - Intronic
1189406243 X:40727339-40727361 TCTTTCATGCTGGTGCAGGATGG - Intronic
1189571107 X:42298388-42298410 CCTTTCGTGGAGGTGGTGGAGGG + Intergenic
1189922230 X:45913754-45913776 CCTTTGAGGGTGGAGCAGGTAGG - Intergenic
1190453860 X:50606861-50606883 CCTTTGATGCTGGTGGTTGTGGG + Intronic
1190893006 X:54587219-54587241 CGTTTCATGGTGGCAGTGGTGGG - Intergenic
1191651174 X:63539135-63539157 CCTGTCATGATGCTGCTGGCTGG - Intergenic
1193666043 X:84318561-84318583 CCTTTTTTGGTGGGGGTGGTGGG - Exonic
1194772062 X:97917645-97917667 CCTGTCATTATGGTGCTGGCTGG - Intergenic
1195112715 X:101663950-101663972 CCCTGCATGGTGGAGGTGGTGGG + Intergenic
1195447985 X:104975744-104975766 CCTCTCCAGGTGGTACTGGTTGG + Intronic
1196215909 X:113051067-113051089 CCTGTGATGGTGGTGTCGGTGGG + Intergenic
1197159613 X:123308747-123308769 ACTTTCATAGTGGTTCTGGATGG + Intronic
1197835420 X:130689192-130689214 CCTTTCAGGATGGGGCTGTTTGG + Intronic
1198189685 X:134289480-134289502 CTTTTTGTGGTGGTGCTGGGGGG + Intergenic
1201399874 Y:13593729-13593751 CCTTTCTTGGTAGTGCTGTTTGG - Intergenic