ID: 1052748764

View in Genome Browser
Species Human (GRCh38)
Location 9:32467455-32467477
Sequence ACCTTTCATGGTGGTGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 10, 3: 33, 4: 286}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052748764_1052748769 13 Left 1052748764 9:32467455-32467477 CCACCAGCACCACCATGAAAGGT 0: 1
1: 0
2: 10
3: 33
4: 286
Right 1052748769 9:32467491-32467513 GGCAAAGCTTCAATCCAAGTTGG No data
1052748764_1052748768 -8 Left 1052748764 9:32467455-32467477 CCACCAGCACCACCATGAAAGGT 0: 1
1: 0
2: 10
3: 33
4: 286
Right 1052748768 9:32467470-32467492 TGAAAGGTTTACATGTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052748764 Original CRISPR ACCTTTCATGGTGGTGCTGG TGG (reversed) Intronic
900832482 1:4975142-4975164 ATCACTCATTGTGGTGCTGGTGG + Intergenic
901000532 1:6146787-6146809 CCCCTTCATGGTGGGGCTGCCGG - Exonic
901660933 1:10797233-10797255 ACCTTACATGGAGGGGCTGGGGG + Intergenic
903151625 1:21414113-21414135 ACCTTCCCTGGTGTTGCTTGAGG + Intergenic
903362613 1:22786327-22786349 AGCTGCAATGGTGGTGCTGGGGG + Intronic
903839348 1:26227122-26227144 ACTTGTCATTGTGGGGCTGGTGG + Intergenic
906209438 1:44003952-44003974 ACTTTGAATGCTGGTGCTGGAGG - Intronic
907692070 1:56679049-56679071 ACATTTCAAGGTGGTGCTGGCGG - Intronic
909665942 1:78133546-78133568 GATTTTGATGGTGGTGCTGGTGG + Intronic
909852799 1:80489643-80489665 TTCTTTCTTGGTGGTGGTGGTGG - Intergenic
910599184 1:89012317-89012339 TCCTTTCCTGATGGTGCTTGGGG - Intronic
911656105 1:100445632-100445654 AACTTTAATGGTGATGCTGAGGG + Intronic
913607196 1:120477011-120477033 ACCTTCCTTGGTGTTGCTTGAGG - Intergenic
913988153 1:143584591-143584613 ACCTTCCTTGGTGCTGCTTGAGG + Intergenic
914268154 1:146055502-146055524 ACCTTCCTTGGTGTTGCTTGAGG + Intergenic
914583997 1:149044827-149044849 ACCTTCCTTGGTGTTGCTTGAGG + Intronic
914892667 1:151640788-151640810 AATCTTCATGGTGGTGGTGGTGG - Intronic
915065174 1:153218924-153218946 ACCTGTGGTGGTGGTGGTGGTGG - Exonic
917434421 1:175005097-175005119 AGCTTTGGTGGTGGTGGTGGTGG + Intronic
917477273 1:175379550-175379572 ACCTGTCAGGGTGGCCCTGGTGG + Exonic
917970111 1:180200860-180200882 ACTTTATATGGTGGTGCTGCTGG + Exonic
920615469 1:207488168-207488190 ACCTTTCAAAGTGGTACTGATGG - Intronic
920712388 1:208307526-208307548 ACCTTTTGTTGTGGTGGTGGTGG - Intergenic
921809491 1:219496522-219496544 ACTTTTCCTGGTGGTGGGGGCGG - Intergenic
922426655 1:225503121-225503143 AATTATCATGGTGGTGGTGGTGG - Intronic
923270586 1:232352013-232352035 ATTCTTCAGGGTGGTGCTGGTGG + Intergenic
1063156812 10:3387320-3387342 AGCTTCCATGGTCGGGCTGGAGG - Intergenic
1065661245 10:28005999-28006021 CATTTTGATGGTGGTGCTGGCGG - Intergenic
1065784026 10:29196414-29196436 ACCTTTCATGTTGGTGGTGTGGG - Intergenic
1066265405 10:33771905-33771927 AACTGTCATGGTGCTGGTGGGGG - Intergenic
1067906352 10:50294971-50294993 GCCTGTACTGGTGGTGCTGGTGG - Intergenic
1068847380 10:61693304-61693326 ACCTTTCATGGAGGAGGTAGGGG + Intronic
1070318398 10:75335747-75335769 CCCTTCCATGGTGGTGTGGGTGG + Intergenic
1071517130 10:86305627-86305649 TCCTATTATGGTGGTGGTGGGGG - Intronic
1072444104 10:95483103-95483125 GGCTTTCTTGGTGGTGGTGGTGG + Intronic
1073612298 10:104956570-104956592 ACCCACCATGGTGGTGGTGGTGG + Intronic
1074404157 10:113166033-113166055 ACCTTTCAAGGTGGGGGTGGGGG - Exonic
1074728964 10:116348177-116348199 ACTCTTCTTGGTGGTGGTGGTGG + Intronic
1076193602 10:128499628-128499650 AGCTGCCATGGTGGTGGTGGTGG - Intergenic
1076252646 10:128996183-128996205 TGCTTTCATGGTGGTGCATGGGG + Intergenic
1077146295 11:1047666-1047688 AGGTTTCTCGGTGGTGCTGGCGG + Intergenic
1077601419 11:3577532-3577554 ACCATTCGTGGTGGTGGTGGGGG - Intergenic
1077645326 11:3918586-3918608 CTCTTTCCTGATGGTGCTGGTGG + Intronic
1078008719 11:7552947-7552969 AACTTACATGCTGGTGCAGGAGG - Intronic
1083214701 11:61211083-61211105 TCCGTTCATGGTGATGCTGAGGG - Exonic
1083217585 11:61229912-61229934 TCCGTTCATGGTGATGCTGAGGG - Exonic
1083220583 11:61249662-61249684 TCCGTTCATGGTGATGCTGAGGG - Exonic
1084815443 11:71643160-71643182 ACCATTCGTGGTGCTGGTGGTGG + Intergenic
1085645234 11:78218383-78218405 TGCTTTCAAGGTGGGGCTGGCGG + Exonic
1087426815 11:97998883-97998905 GCCTGGCATGGTGGTGGTGGTGG - Intergenic
1088212731 11:107474382-107474404 TCTTTACATGGTGGTGGTGGTGG - Intergenic
1088500674 11:110479406-110479428 TCTATTGATGGTGGTGCTGGTGG + Intergenic
1090235281 11:125142356-125142378 TGCTTGCAGGGTGGTGCTGGCGG + Intergenic
1091999593 12:5021312-5021334 ACCTTACAGGTTGGTGCTAGAGG - Intergenic
1092427569 12:8386891-8386913 ACCATTCATGGTGGTGGTGGGGG - Intergenic
1092428834 12:8393869-8393891 ACCATTCATGGTGGTGGTGGGGG - Intergenic
1092779074 12:11968696-11968718 ACCTCCCATGGTGGTGGAGGTGG + Intergenic
1093455136 12:19357553-19357575 CCCTTTTATGGTGGTGGTGATGG + Intronic
1099698975 12:86060835-86060857 ACATTTCTTGGTGCTCCTGGGGG + Intronic
1100253529 12:92858067-92858089 CCCGTTCATGTTGGTGTTGGTGG - Intronic
1101314814 12:103619510-103619532 ATATTTCATGGTGGGGCAGGGGG - Intronic
1101445670 12:104735361-104735383 AGCTCTTCTGGTGGTGCTGGTGG + Intronic
1101600073 12:106201739-106201761 ACCTTTCATGGTTTTGCTGGAGG + Intergenic
1103493849 12:121345567-121345589 CCCTTTCTTGGGGGTCCTGGGGG - Intronic
1103539242 12:121654467-121654489 GGCTTTCCTGGTGGTGTTGGGGG - Intronic
1104805986 12:131589706-131589728 ATCTTTGATGGTGGTGCTGCTGG - Intergenic
1106184321 13:27395508-27395530 AACTTTTATGGTGGTGGGGGAGG - Intergenic
1107293804 13:38888408-38888430 ACCTTTCATTGTGGTGTCTGAGG + Intergenic
1107513816 13:41109881-41109903 ACATTACATGGCGGTGGTGGTGG - Intergenic
1108528355 13:51304787-51304809 AACTGTCATGGTGCTGGTGGGGG - Intergenic
1108975899 13:56442771-56442793 ACCTTTCATGGTGGGGAGTGTGG + Intergenic
1109838134 13:67886019-67886041 AACTATCATGGTGCTGGTGGGGG + Intergenic
1110165352 13:72435825-72435847 ATCTTCCTTGGTGGTGATGGTGG + Intergenic
1110540121 13:76698641-76698663 GCGTTGCAGGGTGGTGCTGGAGG - Intergenic
1112377745 13:98859495-98859517 ACCTTTGCCGGTGGTGGTGGTGG - Intronic
1112391330 13:98987081-98987103 CCCATTGATGGTGGTGGTGGTGG - Intronic
1113368361 13:109699740-109699762 ACGTTTCATGGAGGGGCTGATGG - Intergenic
1113644177 13:111980642-111980664 GGGTTTCATGGTGGTGCTGGGGG + Intergenic
1114447012 14:22796393-22796415 GCCTTTCAGGGTGCTGGTGGGGG - Intronic
1115684858 14:35786216-35786238 AGCCTTGATAGTGGTGCTGGAGG + Intronic
1117377744 14:55130733-55130755 ATTTTTCGTGGTGGTGGTGGTGG + Intronic
1119706907 14:76788697-76788719 ACTTTTCATGTTGGGGCTGTAGG - Exonic
1120144957 14:80969372-80969394 CCCTTAAATGGTGGTGCCGGTGG + Intronic
1121194083 14:92054460-92054482 AACTGTCATGGTGCTGGTGGGGG - Exonic
1121334858 14:93070991-93071013 ACTTGTCATGATGGTGATGGTGG - Intronic
1122065748 14:99173370-99173392 ACCTTGAGTGGTGGTGCTGGGGG - Exonic
1122180668 14:99952104-99952126 ATGTTTCATGGTGGTGGTGATGG + Intergenic
1124211742 15:27770091-27770113 TCCATGCTTGGTGGTGCTGGGGG - Intronic
1125792013 15:42374151-42374173 ACCATGCATGGTGCTGCTGAGGG + Intronic
1126232546 15:46344055-46344077 ACCTTTCATTGAGTTGTTGGGGG + Intergenic
1126873287 15:53011618-53011640 GCCTATGATGGTGGTGATGGTGG + Intergenic
1126890809 15:53202228-53202250 AACTCTCATGGTGATGATGGTGG - Intergenic
1127211867 15:56781812-56781834 AACTGTCATGGTGCTGGTGGTGG - Intronic
1129003677 15:72354630-72354652 ACCTTTCATGCAGGTGCTGATGG - Intronic
1131460566 15:92614730-92614752 ACTATTCATGGTGGAGGTGGTGG + Intergenic
1131460571 15:92614764-92614786 ACCATTCCTGGTGGTGCTGGTGG + Intergenic
1131823208 15:96293759-96293781 ACCTAACATGGTGGGGGTGGGGG + Intergenic
1132673709 16:1113112-1113134 CCCTTCCATGGTGCTGCTGGTGG + Intergenic
1133370675 16:5243488-5243510 ACCATTCGTGGTGCTGGTGGGGG + Intergenic
1133594311 16:7275943-7275965 ACACTTCGTGGTGGTGGTGGTGG - Intronic
1135552133 16:23406639-23406661 CTCTCTGATGGTGGTGCTGGTGG - Intronic
1135767424 16:25189715-25189737 TCATGTAATGGTGGTGCTGGGGG - Intergenic
1136646651 16:31624939-31624961 TCCTTTGGTGGTGGTGGTGGTGG - Intergenic
1137600006 16:49750113-49750135 ACCTATCATGCTGCTGCTCGGGG + Intronic
1138404062 16:56774421-56774443 ACATTTAATGGTGGGGGTGGGGG - Intronic
1138594633 16:58023283-58023305 ACCTTTGATGGTGGGTCGGGTGG + Intergenic
1139936929 16:70578274-70578296 ACCTTTGGTGATGGTGCTGAGGG + Intergenic
1142621860 17:1170311-1170333 ACCCTTCACAGCGGTGCTGGTGG - Intronic
1144015827 17:11194706-11194728 TCATTACATGGTGGTGATGGTGG - Intergenic
1146022898 17:29293798-29293820 GCGTTTCCTGGTGCTGCTGGAGG + Exonic
1146138089 17:30340789-30340811 ACAGTTGATGGTGGTGGTGGTGG - Intergenic
1146576951 17:34002534-34002556 ACCTTTCCTGCTGGTGCTAGTGG - Intronic
1147492665 17:40885064-40885086 AGCGTTTATGGGGGTGCTGGAGG - Exonic
1147498011 17:40936485-40936507 ACCGTCCATGGCGGTGCGGGGGG - Exonic
1147629519 17:41920733-41920755 AGATTTGATGGTGGTGGTGGGGG - Intronic
1147649798 17:42055382-42055404 GCTTTTCCTGGTGGTCCTGGGGG + Intronic
1148004409 17:44414223-44414245 AGTTTTCATGGTGGTAGTGGTGG - Intronic
1148480119 17:47954493-47954515 ACCTTGCAGGGTGGGGCTTGGGG + Intronic
1149637991 17:58185578-58185600 ACCGTCCATGGTGGAGCTGCTGG - Intergenic
1150971990 17:70039293-70039315 AGCTTTCATAGTGGGGCAGGTGG - Intergenic
1151404384 17:73877290-73877312 ACCTGCCATGGAGCTGCTGGTGG + Intergenic
1151699855 17:75737373-75737395 ACCTTCCATGGTGTAGCTGTAGG - Exonic
1152542418 17:80982888-80982910 CCTTTTCACGCTGGTGCTGGCGG + Intergenic
1152756781 17:82090334-82090356 TCCTTTCTTGGAGGTGCTGGGGG + Intronic
1153871028 18:9320270-9320292 ATCTCTCATGCAGGTGCTGGTGG - Intergenic
1155733345 18:29189847-29189869 AGCCTTGATGGTGGTGATGGGGG + Intergenic
1156495738 18:37524265-37524287 GCCTGTGATGTTGGTGCTGGCGG + Intronic
1156815766 18:41309191-41309213 ACCAGTCATGGTGTTGTTGGGGG - Intergenic
1159733865 18:72068716-72068738 ATCTTTCCTGTTGTTGCTGGTGG + Intergenic
1160350196 18:78171859-78171881 TCCTTTCATGGCGGGGGTGGGGG + Intergenic
1160558106 18:79739243-79739265 ACCAGTCAGGGTGTTGCTGGCGG + Intronic
1160836291 19:1126335-1126357 ACCATTCCCGGTGGGGCTGGCGG + Intronic
1161285158 19:3464743-3464765 ACCTCTCTTGGGGGTGATGGGGG - Intronic
1161407276 19:4097709-4097731 ACCTTGCATGGAGCTGCTGGCGG + Intronic
1162187324 19:8915934-8915956 GATTGTCATGGTGGTGCTGGTGG - Intronic
1162883973 19:13682412-13682434 AACTCTCATGGTGCTGGTGGGGG + Intergenic
1163311468 19:16517481-16517503 ACATTCCATGGTGGGGCAGGTGG + Intronic
1165247350 19:34505113-34505135 ACATTTCATGGGGATGATGGGGG + Exonic
1165247829 19:34507734-34507756 ATTTTTCATGGTGGTGGTGATGG + Exonic
1166534063 19:43560948-43560970 AGCTTTCGTGGAGGTGCTGGTGG - Exonic
1167735449 19:51291846-51291868 ACCTGTCATGGTGCTGGTGGGGG + Intergenic
1168322589 19:55518737-55518759 ACCTGCCCTGGTGGAGCTGGTGG + Exonic
926049083 2:9731447-9731469 ACCTTTCTTGGAAGTGCTGGTGG - Intergenic
926142073 2:10373753-10373775 ACCTCTGGGGGTGGTGCTGGTGG - Intronic
927148194 2:20180420-20180442 AGCCTGCATGGTGGTGGTGGTGG + Intergenic
929153664 2:38770722-38770744 ACTTTTTTTGGTGGTGGTGGTGG + Intronic
929318836 2:40515099-40515121 AGCCTTCCTGGTGGTGATGGTGG - Intronic
931193182 2:60025045-60025067 CCCTGTCCTGGTGGTGGTGGTGG - Intergenic
931392466 2:61855474-61855496 ACTTTTGTTGGTGGTGGTGGTGG - Intergenic
932910798 2:75804321-75804343 AACTTTGGTGGTGGTGGTGGTGG + Intergenic
935082706 2:99814245-99814267 TCCTTTGAGGGTGGTGGTGGTGG - Intronic
935656263 2:105426292-105426314 ACTTTTCCTAGTGGGGCTGGGGG - Intronic
935749634 2:106219894-106219916 ACCTTACATGGCAATGCTGGGGG + Intergenic
936121658 2:109751422-109751444 ACCTTACATGGCAATGCTGGAGG - Intergenic
936149664 2:110008366-110008388 AGCTTTAATGATGGTGCTGCTGG - Intergenic
936195014 2:110363003-110363025 AGCTTTAATGATGGTGCTGCTGG + Intergenic
936223039 2:110620052-110620074 ACCTTACATGGCAATGCTGGAGG + Intergenic
936703252 2:115039159-115039181 ACATTTCTTGGTTTTGCTGGAGG + Intronic
937626656 2:124051618-124051640 AGCATTGATGGTGGTGGTGGTGG + Intronic
939209480 2:139155147-139155169 ACTTTTGGTGGTGGTGGTGGTGG + Intergenic
939341502 2:140901269-140901291 AGTTTATATGGTGGTGCTGGAGG - Intronic
939842773 2:147208505-147208527 ACCTTTCATGGAGGTACAGTTGG - Intergenic
940341788 2:152589079-152589101 CCCTTTTTTGGTGGTCCTGGGGG + Intronic
942403253 2:175625791-175625813 GCCTTTCATGGTCTTGTTGGTGG + Intergenic
942519659 2:176790505-176790527 AACTTTCTTGGTGATTCTGGAGG - Intergenic
942689049 2:178565772-178565794 ACCTTTCCTGGTGGGGAAGGAGG + Exonic
944928025 2:204485307-204485329 AACTGTCATGGTGCTGGTGGGGG - Intergenic
946206502 2:218112718-218112740 CCCTAACCTGGTGGTGCTGGAGG - Intergenic
947369296 2:229428143-229428165 ATCTTTCATGTGGGTGGTGGGGG + Intronic
948429177 2:237908406-237908428 ACCTCTGGTGGTGGTGGTGGTGG + Intronic
948923927 2:241081963-241081985 ACCTCTCATCCTGGTGCTTGGGG - Intronic
1170668683 20:18409592-18409614 ACCTTTACTGGTGGTGATGGTGG - Intronic
1170943774 20:20871388-20871410 ACCTGTGATGGTGGTGGCGGTGG + Intergenic
1171316699 20:24201832-24201854 ACCTTGCGTGGAGGTGCTGCTGG - Intergenic
1172110417 20:32541485-32541507 ACCTTGGATGGTGGTGGGGGTGG + Intronic
1172536174 20:35675077-35675099 ACCCTTAGTGGTGGGGCTGGGGG - Exonic
1172877335 20:38173234-38173256 ACTTTCCAGGGTGGTGCTGCAGG - Intergenic
1173025052 20:39299823-39299845 ACCTTTCAAGCTGTAGCTGGTGG + Intergenic
1173539224 20:43838776-43838798 AGCTTTGATGGTGGTGGTGGTGG + Intergenic
1173911381 20:46673536-46673558 ACCAGTCATGGTGATGGTGGCGG - Intronic
1174417715 20:50378545-50378567 TCCTTTGCTGGTGGCGCTGGTGG + Intergenic
1177690006 21:24493645-24493667 ACGTTTCATGGGGGTACTGGTGG - Intergenic
1177710040 21:24762373-24762395 ACATTTCATTGTAGTTCTGGAGG + Intergenic
1177763057 21:25424552-25424574 ACCTTTTATCGTGGAGCTGCTGG + Intergenic
1178715918 21:34964164-34964186 AGCTTCCATGGTGCTGCTGTTGG - Intronic
1178801065 21:35796212-35796234 AGCGTTCGTGGTGATGCTGGTGG + Intronic
1179029016 21:37703791-37703813 ACCTTTCAATGTGGTAGTGGAGG + Intronic
1179284846 21:39968469-39968491 ATTTCTCATGGTGGTTCTGGAGG + Intergenic
1179536397 21:42055525-42055547 ACATTTCAAGGTTGTGCTTGTGG - Intergenic
1181444167 22:22956182-22956204 ACCTTTCGTGGGGGTGCTGGTGG - Intergenic
1181778201 22:25175009-25175031 ACCTTTCATGGAGGTCCCAGGGG + Intronic
1181879904 22:25970169-25970191 AATTTTCATGATGGTGGTGGTGG - Intronic
1182542854 22:31054521-31054543 ACCTTTTTTTGTGGTGGTGGTGG - Intergenic
1183120828 22:35728845-35728867 CCCTTTCTTGCTGGTGCTGGTGG - Exonic
1183399585 22:37594426-37594448 ACCGTTCACGGTGGCGCTGTGGG + Intergenic
1183463464 22:37967108-37967130 CCCTGTGATGGTGGAGCTGGAGG + Exonic
1184200528 22:42965730-42965752 GCCTTTCATCGCGGTGCTAGTGG - Intronic
950426207 3:12925990-12926012 ACCTGGCAGGGTGGTCCTGGTGG + Intronic
950750222 3:15122613-15122635 ACCATTCATGGTGGTGGTGGTGG + Intergenic
952825254 3:37519310-37519332 ATCTATCATGGTGATGCCGGTGG + Exonic
953219989 3:40960875-40960897 CCCTTGCAGGATGGTGCTGGTGG + Intergenic
955544117 3:60009472-60009494 ACCTTTGATGGTGATGATGATGG - Intronic
955811899 3:62799795-62799817 AACTGTGATGGTGGTGGTGGTGG - Intronic
957837844 3:85622158-85622180 ACCATTTATGGTGGTGGTGAAGG - Intronic
958158559 3:89787318-89787340 TCTTTTCTTGGTGGTGGTGGTGG + Intergenic
961678441 3:128582883-128582905 ACCATTCATGCTGGTGGAGGAGG - Intergenic
962308126 3:134306924-134306946 ACCTTGAATGGCAGTGCTGGAGG + Intergenic
963445790 3:145405968-145405990 TGCTTTGATGGTGGTTCTGGAGG - Intergenic
963960971 3:151308698-151308720 ATTCTTCATGGTGGTGGTGGTGG + Intronic
964281504 3:155071671-155071693 ACATTTGATAGTGGTGGTGGTGG - Intronic
965788205 3:172358947-172358969 AGTTTTCTTGGTGGTGGTGGTGG + Intronic
965957843 3:174392164-174392186 AATTTTCTTGGTGGTGCTGTTGG + Intergenic
967117542 3:186355409-186355431 AGTGTTCATGGTGGTGGTGGTGG - Intronic
968761007 4:2442803-2442825 AACTCTGATGCTGGTGCTGGAGG - Intronic
968927098 4:3555187-3555209 AGCTGTCATGGTGCTGGTGGGGG + Intergenic
969614290 4:8243300-8243322 AACTGTCATGGTGCTGGTGGGGG - Intergenic
969738091 4:9004453-9004475 ACCATTCGTGGTGCTGGTGGTGG + Intergenic
969797281 4:9535997-9536019 ACCATTCGTGGTGCTGGTGGTGG + Intergenic
972353506 4:38259543-38259565 AACTGTCATGGTGCTGATGGGGG + Intergenic
972593636 4:40511192-40511214 ACCTTTCAAGGTGATTCTGGCGG - Intronic
973759870 4:54105789-54105811 TCCTTTGATGGTGGTGATGTAGG + Intronic
975840263 4:78466293-78466315 ATCTTTCATGGTGAAGGTGGAGG - Intronic
976277488 4:83292126-83292148 ACAATTCTTGGTAGTGCTGGTGG + Intergenic
978862223 4:113464054-113464076 AACTTTCAGGGTGGTGGTGGTGG - Intronic
979375810 4:119945144-119945166 ACCTTTTATGGTGATGCATGAGG - Intergenic
981670931 4:147286343-147286365 ACCTTTGATGGTGGTGATGGCGG - Intergenic
984672097 4:182502256-182502278 GCCTTTCATGAGGATGCTGGGGG + Intronic
986156297 5:5179797-5179819 ACCCCCCATGGTGGTGCTGATGG + Intronic
987165627 5:15194908-15194930 ACCTGTGGTGGTGGTGGTGGTGG + Intergenic
990250703 5:53911837-53911859 ATCTTTCAGGGTAGTGATGGTGG + Intronic
992750731 5:79858076-79858098 ACCCTGCATGTTGATGCTGGTGG - Intergenic
998483888 5:142485291-142485313 ACCTTTCATGATGGAGGTGGTGG - Intergenic
1001304311 5:170560582-170560604 TCCTTTCTTGGTGGTGAAGGGGG + Intronic
1003144587 6:3499134-3499156 AGCCTTCATGGTGGTTCTGCAGG + Intergenic
1003158932 6:3619023-3619045 GCCAATCATGGTGGTGGTGGGGG - Intergenic
1004882704 6:20024382-20024404 ACCTTTCAGGTTTGAGCTGGAGG + Intergenic
1005395423 6:25377498-25377520 ACACTCCAGGGTGGTGCTGGGGG + Intronic
1005823710 6:29619126-29619148 ACCTTTCCAGGTGGTTCTGACGG + Intronic
1008062833 6:47016452-47016474 AAGTTTCATCTTGGTGCTGGGGG + Intronic
1008280418 6:49589368-49589390 ACCTTTTATTATGTTGCTGGTGG - Intergenic
1014221243 6:118800812-118800834 CCCTTTCACGGTGGTGCTCCAGG + Intergenic
1015628157 6:135203378-135203400 ATCTTTGGTGGTGGTGGTGGTGG + Intronic
1016788788 6:148044062-148044084 ACTTCTCATGGCAGTGCTGGGGG + Intergenic
1017070356 6:150570573-150570595 ATCTGTCCTGGTGGTGCTGTGGG + Intergenic
1017713521 6:157190899-157190921 ACCTGTCATGGGGGTGGTGGTGG + Intronic
1018415593 6:163599844-163599866 AACTGTCATGGTGCTGGTGGTGG - Intergenic
1018481925 6:164199681-164199703 ACTTTTCATGGGGGTGGGGGGGG - Intergenic
1022214846 7:28248672-28248694 TCCTCTCATGGTGATACTGGGGG + Intergenic
1023532525 7:41173196-41173218 AGCATTCATGGTGGTGATGTTGG - Intergenic
1024222583 7:47300118-47300140 ACATTTCAGGGTGATGCAGGAGG - Intronic
1026436751 7:70405991-70406013 GCAATTCATGGTGGTGGTGGCGG + Intronic
1027178403 7:75919874-75919896 TCCTTTCATTGGAGTGCTGGAGG + Intronic
1027455606 7:78387585-78387607 AGCCTTCATTGTGGTGATGGAGG - Intronic
1027580334 7:79985947-79985969 AACTTTCATGTTGATGTTGGTGG - Intergenic
1029074535 7:97925543-97925565 ACCATTCATGGTGGTGGTGGTGG - Intergenic
1034028286 7:147732186-147732208 GCCTGTCATGGGGGTGGTGGGGG - Intronic
1034460472 7:151195385-151195407 ACTTTGCATGGTGGTGGTGGTGG - Intronic
1035626052 8:1071386-1071408 ATCATCCAGGGTGGTGCTGGAGG - Intergenic
1036243176 8:7095741-7095763 ATCATTCATGGTGGTGGTGGTGG + Intergenic
1036257625 8:7218317-7218339 ACCATTCGTGGTGGTGGTGGGGG - Intergenic
1036258877 8:7225316-7225338 ACCATTCGTGGTGCTGGTGGTGG - Intergenic
1036307743 8:7614194-7614216 ACCATTCGTGGTGCTGGTGGTGG + Intergenic
1036309677 8:7676913-7676935 ACCATTCGTGGTGGTGGTGGGGG - Intergenic
1036310932 8:7683912-7683934 ACCATTCGTGGTGCTGGTGGTGG - Intergenic
1036358597 8:8062195-8062217 ACCATTCGTGGTGCTGGTGGTGG + Intergenic
1036359861 8:8069206-8069228 ACCATTCGTGGTGGTGGTGGGGG + Intergenic
1036891096 8:12597764-12597786 ACCATTCGTGGTGGTGGTGGGGG - Intergenic
1036892362 8:12604757-12604779 ACCATTCGTGGTGCTGGTGGTGG - Intergenic
1036898653 8:12655690-12655712 ACCATTCATGGTGGTGGTGGTGG - Intergenic
1036899906 8:12662733-12662755 ACCATTCGTGGTGCTGGTGGTGG - Intergenic
1039408095 8:37329688-37329710 GCCTTTCATCCTGGTGCTGACGG - Intergenic
1039415098 8:37386615-37386637 CCCTTTCATGGTGGCCCAGGAGG - Intergenic
1039429737 8:37516496-37516518 ACCTTGCATGGTGCCGGTGGTGG - Intergenic
1039479161 8:37858868-37858890 ACCTCTCTTGGTGGGGGTGGGGG - Intronic
1039866291 8:41506246-41506268 ATCTTTCCTGGTGGTTCTGAGGG + Intronic
1041293658 8:56332897-56332919 ACCTGTTCTGGTGGTGGTGGGGG + Intergenic
1041611188 8:59851265-59851287 ACCTTTGCTGGTGGGGCTGAAGG + Intergenic
1041904196 8:63013490-63013512 ATCTTTCCTGCTGGTGGTGGTGG + Intergenic
1042007818 8:64201895-64201917 GCCATTCATGGTGGTCCAGGTGG - Intergenic
1042324009 8:67509014-67509036 AGCTTACATGGTGGAGCAGGAGG + Intronic
1042655145 8:71087607-71087629 ACCTTTTGTGGTGGTGGTGGGGG + Intergenic
1042920527 8:73915002-73915024 ATCTGTCATGGTGCTGCTGGGGG + Intergenic
1043564206 8:81529795-81529817 ACATGTCATGGTGGAGCTGCTGG - Intronic
1044863372 8:96545420-96545442 ACCTGTCATGGTGTTTCTCGAGG - Intronic
1045854834 8:106752780-106752802 AGCTTACATTGTGGTGGTGGTGG + Intergenic
1045978015 8:108151170-108151192 TCCTGTCATCATGGTGCTGGTGG - Intergenic
1046492992 8:114977460-114977482 AACTTTGGTGGAGGTGCTGGAGG + Intergenic
1048261609 8:132949973-132949995 TCCAGTGATGGTGGTGCTGGTGG - Intronic
1049227088 8:141459678-141459700 AACTTTGGTGGTGGTGGTGGAGG + Intergenic
1050012643 9:1200780-1200802 ACCTTTCATGGTGGTCAGGGAGG - Intergenic
1052748764 9:32467455-32467477 ACCTTTCATGGTGGTGCTGGTGG - Intronic
1053160589 9:35810923-35810945 GTCTTTCTGGGTGGTGCTGGAGG + Exonic
1053802019 9:41770575-41770597 AACTGTCATGGTGCTGGTGGGGG + Intergenic
1054143248 9:61544714-61544736 AACTGTCATGGTGCTGGTGGGGG - Intergenic
1054190398 9:61982270-61982292 AACTGTCATGGTGCTGGTGGGGG + Intergenic
1054462958 9:65475595-65475617 AACTGTCATGGTGCTGGTGGGGG - Intergenic
1054648067 9:67605856-67605878 AACTGTCATGGTGCTGGTGGGGG - Intergenic
1056144881 9:83719654-83719676 ACCCGGCATGGTGGTGGTGGAGG - Intergenic
1056717042 9:89040234-89040256 AATTTTGATGGTGGTGGTGGTGG - Intronic
1058620402 9:106877166-106877188 AGCTTTATTGGTGGTGGTGGTGG + Intronic
1060085355 9:120695096-120695118 ACCTTACATTCTAGTGCTGGTGG + Intronic
1060135100 9:121146236-121146258 ACTTTTGATGATGGTGGTGGTGG - Exonic
1060349255 9:122843318-122843340 ACCTCTCAAGGAGGTGGTGGTGG - Intergenic
1060894723 9:127210272-127210294 ACCTTGCATGTTGGGCCTGGGGG - Intronic
1061403595 9:130381869-130381891 AGCCTTCATGGCAGTGCTGGGGG - Intronic
1061804997 9:133132947-133132969 AACTTTCATAGTGGGGGTGGGGG + Intronic
1186785045 X:12949319-12949341 TCTTTTCATGGAGGTTCTGGGGG - Intergenic
1187436247 X:19272558-19272580 AACTCTCATGCTGCTGCTGGTGG + Intergenic
1187485409 X:19698626-19698648 GCCCTTCATGGGGGTGGTGGGGG + Intronic
1187848596 X:23567000-23567022 AGATTTGATGGTGGGGCTGGTGG + Intergenic
1189188470 X:39074428-39074450 ATATGTGATGGTGGTGCTGGAGG - Intergenic
1189390408 X:40571457-40571479 AACTGTCATGGTGCTGGTGGGGG + Intergenic
1189571105 X:42298387-42298409 TCCTTTCGTGGAGGTGGTGGAGG + Intergenic
1190063044 X:47223069-47223091 GCCTTTGAGGGTGGTGCTAGGGG + Exonic
1190453858 X:50606860-50606882 ACCTTTGATGCTGGTGGTTGTGG + Intronic
1190736501 X:53258877-53258899 ACTTTTGGTGGTGGTGGTGGTGG - Intronic
1190893007 X:54587220-54587242 ACGTTTCATGGTGGCAGTGGTGG - Intergenic
1192970140 X:76220160-76220182 ACCTTCCCTGGTGTTGCTAGAGG - Intergenic
1193493674 X:82183805-82183827 ATATTCCATGGTGGTGGTGGTGG + Intergenic
1193493800 X:82185841-82185863 ATATTCCATGGTGGTGGTGGTGG - Intergenic
1194803109 X:98295610-98295632 AACTGTCATGGTGCTGATGGGGG - Intergenic
1195397139 X:104423673-104423695 ACCTTTCATGTTGATGCATGTGG + Intergenic
1198189684 X:134289479-134289501 CCTTTTTGTGGTGGTGCTGGGGG + Intergenic
1198575263 X:138003867-138003889 TCTTTCCATGGTGGTGGTGGGGG - Intergenic
1198677087 X:139142777-139142799 TACTTTCATTGTGGTGGTGGTGG + Intronic
1199019234 X:142856237-142856259 TGCTTTCATGGTGGTGGTGGTGG - Intergenic
1199187743 X:144937131-144937153 AGCTGTCGTGGTGGTGGTGGTGG + Intergenic
1201499120 Y:14622449-14622471 ATCTTTCATCCAGGTGCTGGGGG - Exonic
1201748858 Y:17410715-17410737 AACTGTCATGGTGCTGGTGGGGG - Intergenic
1201931519 Y:19354676-19354698 GCCTTTCCTGGTGGAGCTGTGGG - Intergenic