ID: 1052748768

View in Genome Browser
Species Human (GRCh38)
Location 9:32467470-32467492
Sequence TGAAAGGTTTACATGTTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052748764_1052748768 -8 Left 1052748764 9:32467455-32467477 CCACCAGCACCACCATGAAAGGT 0: 1
1: 0
2: 10
3: 33
4: 286
Right 1052748768 9:32467470-32467492 TGAAAGGTTTACATGTTGACTGG No data
1052748758_1052748768 21 Left 1052748758 9:32467426-32467448 CCCTTCTTGAATACAGGGGGCCC 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1052748768 9:32467470-32467492 TGAAAGGTTTACATGTTGACTGG No data
1052748762_1052748768 -7 Left 1052748762 9:32467454-32467476 CCCACCAGCACCACCATGAAAGG 0: 1
1: 0
2: 4
3: 22
4: 252
Right 1052748768 9:32467470-32467492 TGAAAGGTTTACATGTTGACTGG No data
1052748760_1052748768 1 Left 1052748760 9:32467446-32467468 CCCTTCAGCCCACCAGCACCACC 0: 1
1: 0
2: 3
3: 47
4: 420
Right 1052748768 9:32467470-32467492 TGAAAGGTTTACATGTTGACTGG No data
1052748761_1052748768 0 Left 1052748761 9:32467447-32467469 CCTTCAGCCCACCAGCACCACCA 0: 1
1: 0
2: 7
3: 122
4: 780
Right 1052748768 9:32467470-32467492 TGAAAGGTTTACATGTTGACTGG No data
1052748759_1052748768 20 Left 1052748759 9:32467427-32467449 CCTTCTTGAATACAGGGGGCCCT 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1052748768 9:32467470-32467492 TGAAAGGTTTACATGTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052748768 Original CRISPR TGAAAGGTTTACATGTTGAC TGG Intronic
No off target data available for this crispr