ID: 1052751873

View in Genome Browser
Species Human (GRCh38)
Location 9:32499910-32499932
Sequence ATGTCCAGCTTGAGTTTGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052751864_1052751873 23 Left 1052751864 9:32499864-32499886 CCTGCCTCAGCCTCCTGAGAGGC 0: 21
1: 1872
2: 85780
3: 187042
4: 228013
Right 1052751873 9:32499910-32499932 ATGTCCAGCTTGAGTTTGTTCGG No data
1052751866_1052751873 19 Left 1052751866 9:32499868-32499890 CCTCAGCCTCCTGAGAGGCTGGG 0: 32
1: 2399
2: 102437
3: 209809
4: 255325
Right 1052751873 9:32499910-32499932 ATGTCCAGCTTGAGTTTGTTCGG No data
1052751868_1052751873 13 Left 1052751868 9:32499874-32499896 CCTCCTGAGAGGCTGGGACTACA 0: 5
1: 1084
2: 46837
3: 168872
4: 229502
Right 1052751873 9:32499910-32499932 ATGTCCAGCTTGAGTTTGTTCGG No data
1052751862_1052751873 26 Left 1052751862 9:32499861-32499883 CCTCCTGCCTCAGCCTCCTGAGA 0: 111
1: 5543
2: 13427
3: 34978
4: 80222
Right 1052751873 9:32499910-32499932 ATGTCCAGCTTGAGTTTGTTCGG No data
1052751870_1052751873 10 Left 1052751870 9:32499877-32499899 CCTGAGAGGCTGGGACTACAGGC 0: 13
1: 1485
2: 79659
3: 203629
4: 265572
Right 1052751873 9:32499910-32499932 ATGTCCAGCTTGAGTTTGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052751873 Original CRISPR ATGTCCAGCTTGAGTTTGTT CGG Intronic
No off target data available for this crispr