ID: 1052752220

View in Genome Browser
Species Human (GRCh38)
Location 9:32503413-32503435
Sequence TCCCACTGCCTTTGCTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052752219_1052752220 14 Left 1052752219 9:32503376-32503398 CCAACAATGCAGACAAAACTTCA No data
Right 1052752220 9:32503413-32503435 TCCCACTGCCTTTGCTGTCCTGG No data
1052752218_1052752220 25 Left 1052752218 9:32503365-32503387 CCTCAAAAGCACCAACAATGCAG No data
Right 1052752220 9:32503413-32503435 TCCCACTGCCTTTGCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052752220 Original CRISPR TCCCACTGCCTTTGCTGTCC TGG Intronic