ID: 1052754991

View in Genome Browser
Species Human (GRCh38)
Location 9:32531840-32531862
Sequence ATCAAAAAGCAGAAACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052754991_1052754994 -10 Left 1052754991 9:32531840-32531862 CCCTCCAGTTTCTGCTTTTTGAT No data
Right 1052754994 9:32531853-32531875 GCTTTTTGATTGCCCTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052754991 Original CRISPR ATCAAAAAGCAGAAACTGGA GGG (reversed) Intergenic
No off target data available for this crispr