ID: 1052759736

View in Genome Browser
Species Human (GRCh38)
Location 9:32578069-32578091
Sequence CAGTGGGAACCTATTTAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052759736_1052759742 26 Left 1052759736 9:32578069-32578091 CCAACTTAAATAGGTTCCCACTG No data
Right 1052759742 9:32578118-32578140 GACAAGTATAATAACTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052759736 Original CRISPR CAGTGGGAACCTATTTAAGT TGG (reversed) Intergenic
No off target data available for this crispr