ID: 1052762957

View in Genome Browser
Species Human (GRCh38)
Location 9:32611299-32611321
Sequence TACCAAATACCTGTTCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052762957_1052762958 1 Left 1052762957 9:32611299-32611321 CCTGTGGGAACAGGTATTTGGTA No data
Right 1052762958 9:32611323-32611345 CAGCTAGAATTCACATGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052762957 Original CRISPR TACCAAATACCTGTTCCCAC AGG (reversed) Intergenic
No off target data available for this crispr