ID: 1052762958

View in Genome Browser
Species Human (GRCh38)
Location 9:32611323-32611345
Sequence CAGCTAGAATTCACATGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052762957_1052762958 1 Left 1052762957 9:32611299-32611321 CCTGTGGGAACAGGTATTTGGTA No data
Right 1052762958 9:32611323-32611345 CAGCTAGAATTCACATGCTCAGG No data
1052762956_1052762958 2 Left 1052762956 9:32611298-32611320 CCCTGTGGGAACAGGTATTTGGT No data
Right 1052762958 9:32611323-32611345 CAGCTAGAATTCACATGCTCAGG No data
1052762950_1052762958 18 Left 1052762950 9:32611282-32611304 CCATTTTCTCCTGGGACCCTGTG No data
Right 1052762958 9:32611323-32611345 CAGCTAGAATTCACATGCTCAGG No data
1052762954_1052762958 9 Left 1052762954 9:32611291-32611313 CCTGGGACCCTGTGGGAACAGGT No data
Right 1052762958 9:32611323-32611345 CAGCTAGAATTCACATGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052762958 Original CRISPR CAGCTAGAATTCACATGCTC AGG Intergenic
No off target data available for this crispr