ID: 1052772499

View in Genome Browser
Species Human (GRCh38)
Location 9:32702747-32702769
Sequence CTTTCCAAATCTGAGTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052772499_1052772503 1 Left 1052772499 9:32702747-32702769 CCTCAAAACTCAGATTTGGAAAG No data
Right 1052772503 9:32702771-32702793 GGTAAGATCATCAGTAAAAATGG No data
1052772499_1052772505 19 Left 1052772499 9:32702747-32702769 CCTCAAAACTCAGATTTGGAAAG No data
Right 1052772505 9:32702789-32702811 AATGGCCCAAAATACTGTCTGGG No data
1052772499_1052772504 18 Left 1052772499 9:32702747-32702769 CCTCAAAACTCAGATTTGGAAAG No data
Right 1052772504 9:32702788-32702810 AAATGGCCCAAAATACTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052772499 Original CRISPR CTTTCCAAATCTGAGTTTTG AGG (reversed) Intergenic
No off target data available for this crispr