ID: 1052772500

View in Genome Browser
Species Human (GRCh38)
Location 9:32702748-32702770
Sequence CTCAAAACTCAGATTTGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052772496_1052772500 24 Left 1052772496 9:32702701-32702723 CCTGATAGACAGGGTGTGGGTGG No data
Right 1052772500 9:32702748-32702770 CTCAAAACTCAGATTTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052772500 Original CRISPR CTCAAAACTCAGATTTGGAA AGG Intergenic
No off target data available for this crispr