ID: 1052772623

View in Genome Browser
Species Human (GRCh38)
Location 9:32703602-32703624
Sequence GGAATGGTTGGCCGAGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052772623_1052772631 8 Left 1052772623 9:32703602-32703624 CCAGGAACTCGGCCAACCATTCC No data
Right 1052772631 9:32703633-32703655 TCCTTTTCAAGAACAACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052772623 Original CRISPR GGAATGGTTGGCCGAGTTCC TGG (reversed) Intergenic