ID: 1052774225

View in Genome Browser
Species Human (GRCh38)
Location 9:32717711-32717733
Sequence CTTCTACTATTCAGAAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052774221_1052774225 3 Left 1052774221 9:32717685-32717707 CCTTCCTTCATATCACCAAAGTC No data
Right 1052774225 9:32717711-32717733 CTTCTACTATTCAGAAAAAAGGG No data
1052774217_1052774225 14 Left 1052774217 9:32717674-32717696 CCACCAACGCCCCTTCCTTCATA No data
Right 1052774225 9:32717711-32717733 CTTCTACTATTCAGAAAAAAGGG No data
1052774219_1052774225 5 Left 1052774219 9:32717683-32717705 CCCCTTCCTTCATATCACCAAAG No data
Right 1052774225 9:32717711-32717733 CTTCTACTATTCAGAAAAAAGGG No data
1052774218_1052774225 11 Left 1052774218 9:32717677-32717699 CCAACGCCCCTTCCTTCATATCA No data
Right 1052774225 9:32717711-32717733 CTTCTACTATTCAGAAAAAAGGG No data
1052774222_1052774225 -1 Left 1052774222 9:32717689-32717711 CCTTCATATCACCAAAGTCATTC No data
Right 1052774225 9:32717711-32717733 CTTCTACTATTCAGAAAAAAGGG No data
1052774220_1052774225 4 Left 1052774220 9:32717684-32717706 CCCTTCCTTCATATCACCAAAGT No data
Right 1052774225 9:32717711-32717733 CTTCTACTATTCAGAAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052774225 Original CRISPR CTTCTACTATTCAGAAAAAA GGG Intergenic
No off target data available for this crispr