ID: 1052781464

View in Genome Browser
Species Human (GRCh38)
Location 9:32784627-32784649
Sequence CCTGATGCCCATTCTGGACG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052781464_1052781473 17 Left 1052781464 9:32784627-32784649 CCTCGTCCAGAATGGGCATCAGG 0: 1
1: 0
2: 3
3: 9
4: 90
Right 1052781473 9:32784667-32784689 CTGGACGGCTACTGCCCCTCGGG 0: 1
1: 0
2: 0
3: 4
4: 93
1052781464_1052781468 -2 Left 1052781464 9:32784627-32784649 CCTCGTCCAGAATGGGCATCAGG 0: 1
1: 0
2: 3
3: 9
4: 90
Right 1052781468 9:32784648-32784670 GGAGGAGACGTCCAGATACCTGG 0: 1
1: 0
2: 1
3: 10
4: 118
1052781464_1052781472 16 Left 1052781464 9:32784627-32784649 CCTCGTCCAGAATGGGCATCAGG 0: 1
1: 0
2: 3
3: 9
4: 90
Right 1052781472 9:32784666-32784688 CCTGGACGGCTACTGCCCCTCGG 0: 1
1: 0
2: 3
3: 11
4: 121
1052781464_1052781469 2 Left 1052781464 9:32784627-32784649 CCTCGTCCAGAATGGGCATCAGG 0: 1
1: 0
2: 3
3: 9
4: 90
Right 1052781469 9:32784652-32784674 GAGACGTCCAGATACCTGGACGG 0: 1
1: 10
2: 1
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052781464 Original CRISPR CCTGATGCCCATTCTGGACG AGG (reversed) Exonic
900168642 1:1255373-1255395 GCTGAATCCCGTTCTGGACGAGG + Exonic
903361499 1:22780080-22780102 CCTGATGCCCATTATGTACCAGG - Intronic
905691139 1:39943875-39943897 CCTCATGTCCCTTCTGGAGGTGG - Intergenic
906559678 1:46747225-46747247 CCTATTGGTCATTCTGGACGTGG + Intergenic
907501320 1:54883632-54883654 CCTGATGGACATTCTGGAAGTGG - Exonic
910674377 1:89801916-89801938 CCTGATGCCCTTTGTGGAGAGGG + Intronic
913151599 1:116049483-116049505 CCTGATGCTCATTCAGGAGCAGG - Intronic
918516614 1:185370363-185370385 GCTGTTGCCCATGCTGGACATGG - Intergenic
920404217 1:205697074-205697096 CCCCATGCCCACTCTGGAGGAGG + Intergenic
921242455 1:213199536-213199558 GCTATTGCCCATTCAGGACGAGG - Intronic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
922891835 1:229067698-229067720 CCTGATGCACAGCCTGGAGGAGG - Intergenic
923033307 1:230266706-230266728 CCCCATGCCCATGCTGGATGGGG - Intronic
1064436170 10:15313052-15313074 CCTGATTTCCATTCTGGCCTGGG + Intronic
1065361667 10:24894864-24894886 CCTGATGCCCACTCTGAGCCAGG - Intronic
1066681914 10:37942815-37942837 CCTGATGTCCATTCTGGATGGGG + Intergenic
1067777067 10:49171529-49171551 CCTGATGCCCCATTTGGACCTGG + Intronic
1068135410 10:52947967-52947989 TCTGATGTCCATTCTGGATGGGG - Intergenic
1071446948 10:85757372-85757394 TCTGATGCCCAATCTGCACATGG + Intronic
1073111540 10:101065862-101065884 CCTGTTCCCCATTCTGGCCTGGG - Intronic
1074096222 10:110315193-110315215 CATGTTGCCCATGCTGGACTTGG + Intergenic
1076994030 11:289651-289673 CCTGAGGCCCCTCCTAGACGGGG - Intronic
1077647264 11:3936674-3936696 GCTGCAGCCCATTCTGGACTTGG + Intronic
1083369809 11:62169538-62169560 CCTGATCGCCAGTCTGGAAGTGG + Intergenic
1084268024 11:68014879-68014901 CCTGATGCCCCTCCTGGAGGCGG - Intronic
1089386765 11:118073643-118073665 CCTGTTGCCCTTCCTGGAGGAGG - Intergenic
1096079675 12:48825144-48825166 CCTCATGTCCATTCTGCAGGCGG + Exonic
1102857517 12:116307057-116307079 CCTGAGTCCCATTCTGAATGGGG - Intergenic
1103454212 12:121052190-121052212 CCAGATGCCCCTTCAGGACTGGG + Intergenic
1110204651 13:72898196-72898218 CCTGATGCTCATTCAGGAGCAGG - Intronic
1110412650 13:75220696-75220718 CCTGATGCCGATTCTAGTAGTGG - Intergenic
1121493672 14:94377789-94377811 CCTGAAGCCCATTCTCCATGGGG - Exonic
1121639302 14:95474695-95474717 TCTCATGCCCTTTCTGGAAGTGG - Intronic
1125721385 15:41846769-41846791 CCTGCAGCCCACTCGGGACGTGG + Exonic
1128987445 15:72231434-72231456 CCTGATGACCAATGGGGACGCGG + Intronic
1130722210 15:86399566-86399588 CCTGTTGACCATTCTGGAAAAGG + Intronic
1131047309 15:89324265-89324287 CCAGATGCCCACTCTGGGCCAGG + Intronic
1132864505 16:2086751-2086773 CCTGATGCCCACCAAGGACGTGG + Exonic
1134684763 16:16150699-16150721 CCAGATCCTCATCCTGGACGAGG - Exonic
1145811727 17:27768387-27768409 CCTCATGCCCACACTGGAAGAGG + Intronic
1148099724 17:45081490-45081512 CCAAATGCCCTTTCTGGACCTGG + Intronic
1149334071 17:55617579-55617601 TCTGCTGCTCATTCTGGAAGGGG + Intergenic
1149641753 17:58207245-58207267 CCACATGCCCTTTCTGGACCTGG - Intronic
1150938578 17:69664172-69664194 TCTCATGCCCATTCTGGAATTGG - Intergenic
1156658061 18:39310668-39310690 CCTGTTGCACATCCTGGAGGGGG + Intergenic
1161312023 19:3600121-3600143 CCTGCTGCCCCTGCTGGGCGTGG - Exonic
1161837564 19:6658324-6658346 CCTGATGTCCATTCTGGACAGGG - Intergenic
1162060965 19:8095006-8095028 CCTGTTGCCCAGGCTGGATGCGG + Intronic
1163020376 19:14478217-14478239 CCTGGTTCCCAGTCTGGCCGGGG - Exonic
1164062749 19:21689769-21689791 CCTGATATCCATTCTGGATGGGG - Intergenic
1165137041 19:33675990-33676012 CCTCATGTCCATTCTGGATTTGG + Intronic
1165252811 19:34554299-34554321 CCTGATGTCCATTCTAGGTGGGG - Intergenic
1165272979 19:34726146-34726168 CCTGATGTCCATTCTGGGCAGGG + Intergenic
937037379 2:118793299-118793321 CCTGTTGCCCATGCTGAATGGGG - Intergenic
937419432 2:121741720-121741742 CCTGATCCCCATTCTGATGGTGG - Intronic
948961880 2:241345387-241345409 CCTGATCCCCATTATTGAGGGGG + Intronic
1169321177 20:4634506-4634528 CTTGATTCCCATTCTGGAAGCGG + Intergenic
1171249558 20:23637811-23637833 CCTGCTGGCCATCCTGGCCGTGG - Exonic
1175824695 20:61930569-61930591 CCTGCCGCCTGTTCTGGACGTGG - Intronic
1175945032 20:62554711-62554733 ACTGATGGCCATCCTGGAAGAGG + Intronic
1176180444 20:63747224-63747246 CCTGATGCCCACGCTGGCGGCGG + Exonic
1177678360 21:24332571-24332593 CCTGGTGCACAATTTGGACGGGG - Intergenic
1180207408 21:46269710-46269732 TCTGCTGCCCATTCTGGCAGCGG - Intronic
1180951901 22:19724224-19724246 CCTGCTGCCCTATCTGGCCGAGG + Exonic
1182219245 22:28744740-28744762 CCTGATGCCCATTATGGCGTAGG + Intronic
1182318247 22:29462146-29462168 CCTGATGGCCACTCTGCACCTGG - Intergenic
1182721666 22:32406724-32406746 CCTGATGTCCATTCAGGATATGG - Exonic
949606470 3:5659430-5659452 CTTGATGGCCAATCTGGAAGAGG - Intergenic
951496162 3:23329265-23329287 CCTGATGTCCATTCTGACAGAGG - Intronic
961265392 3:125637582-125637604 CCTAATGCCCAAGCTGGAAGGGG - Intergenic
962400529 3:135055501-135055523 GCTGATGGCCATTGTGGACAAGG - Intronic
966083482 3:176036389-176036411 CTTGATGCCAAATCTGGACAGGG + Intergenic
966452841 3:180081765-180081787 CTTGGTGCCCATTCTTGAGGGGG - Intergenic
981549918 4:145933672-145933694 CCTGATGCCTATTCCCGAGGGGG - Intronic
982212858 4:153054843-153054865 CCATATGCCCATTATGGAAGGGG - Intergenic
984194320 4:176640203-176640225 CTTGATGGCCATTCTTGACCCGG - Intergenic
994883381 5:105527279-105527301 CCTGATGCTCATTCAGGAGCAGG + Intergenic
996537332 5:124592108-124592130 CCTGATGCCCATTTGGGAATGGG - Intergenic
997649458 5:135504800-135504822 CCTCATGCTCATTTTTGACGGGG - Intergenic
998138458 5:139686967-139686989 CCTGAGGCCCAGTCTGGATGGGG + Intergenic
998920096 5:147058672-147058694 CCTCTTGCCCATTCTGCATGTGG - Intronic
999722728 5:154410976-154410998 CGTGAGGCCCATGCTGGCCGAGG + Intronic
1007186204 6:39974578-39974600 GCTGATGCCCTTTGTGGTCGTGG + Intergenic
1013029205 6:106314521-106314543 CCTGTTGCCCAGGCTGGAGGGGG - Intronic
1019470704 7:1219047-1219069 CCTCCTGCCTATTCTGAACGTGG + Intergenic
1021180231 7:17497461-17497483 CCTGATGCCCAGGCTGAACCTGG - Intergenic
1022358462 7:29638006-29638028 CCTGATGTCCATTCTGGATGGGG - Intergenic
1023097277 7:36673832-36673854 CATGATGCGCTTTCTGGACAGGG - Intronic
1033230732 7:139595417-139595439 CCTGAGGCCATTTCTGGACTAGG + Intronic
1036598353 8:10235824-10235846 CTTGATACCAATTCTGGACAAGG + Intronic
1046686411 8:117232470-117232492 CCTGATCCCTATTCTGGATTGGG - Intergenic
1049731413 8:144180465-144180487 CCTGCTGCCCGTGCTGGGCGTGG + Exonic
1052781464 9:32784627-32784649 CCTGATGCCCATTCTGGACGAGG - Exonic
1055937796 9:81619588-81619610 CCTGATGCCCTTGCAGGAAGAGG - Intronic
1062009435 9:134259160-134259182 CCTGGTGCCCACTCTGGCCCTGG + Intergenic
1188262428 X:28036493-28036515 CCTGATGCCCCTTCAGCAAGAGG - Intergenic
1188284804 X:28314507-28314529 CCTCCTGGCCATTCTGGAAGGGG + Intergenic
1193760267 X:85456898-85456920 TCTGATTTCCATTCTGGATGGGG + Intergenic
1195019268 X:100810271-100810293 CCCAATGCTCATTCTGGACCAGG + Intergenic
1201643664 Y:16204064-16204086 CCTGATATCCATTCTGGGTGGGG + Intergenic
1201659151 Y:16381257-16381279 CCTGATATCCATTCTGGGTGGGG - Intergenic
1202338181 Y:23831935-23831957 CCTGATGTCCATTCTAGGCAGGG + Intergenic
1202532585 Y:25838136-25838158 CCTGATGTCCATTCTAGGCAGGG - Intergenic