ID: 1052786677

View in Genome Browser
Species Human (GRCh38)
Location 9:32834759-32834781
Sequence AACTGCATGCAGCAACATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052786673_1052786677 25 Left 1052786673 9:32834711-32834733 CCCTATGGCCTTAAGAGTGTTTG No data
Right 1052786677 9:32834759-32834781 AACTGCATGCAGCAACATGCAGG No data
1052786674_1052786677 24 Left 1052786674 9:32834712-32834734 CCTATGGCCTTAAGAGTGTTTGA No data
Right 1052786677 9:32834759-32834781 AACTGCATGCAGCAACATGCAGG No data
1052786675_1052786677 17 Left 1052786675 9:32834719-32834741 CCTTAAGAGTGTTTGATTTTCTT No data
Right 1052786677 9:32834759-32834781 AACTGCATGCAGCAACATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052786677 Original CRISPR AACTGCATGCAGCAACATGC AGG Intergenic
No off target data available for this crispr