ID: 1052787219

View in Genome Browser
Species Human (GRCh38)
Location 9:32840088-32840110
Sequence AAATAGGCAATTTGGGCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052787219_1052787225 7 Left 1052787219 9:32840088-32840110 CCTATAGCCCAAATTGCCTATTT No data
Right 1052787225 9:32840118-32840140 AGCAAAAAGGACATGAGCTAAGG No data
1052787219_1052787228 26 Left 1052787219 9:32840088-32840110 CCTATAGCCCAAATTGCCTATTT No data
Right 1052787228 9:32840137-32840159 AAGGAGATCTAAGTCATGGGCGG No data
1052787219_1052787227 23 Left 1052787219 9:32840088-32840110 CCTATAGCCCAAATTGCCTATTT No data
Right 1052787227 9:32840134-32840156 GCTAAGGAGATCTAAGTCATGGG No data
1052787219_1052787226 22 Left 1052787219 9:32840088-32840110 CCTATAGCCCAAATTGCCTATTT No data
Right 1052787226 9:32840133-32840155 AGCTAAGGAGATCTAAGTCATGG No data
1052787219_1052787223 -6 Left 1052787219 9:32840088-32840110 CCTATAGCCCAAATTGCCTATTT No data
Right 1052787223 9:32840105-32840127 CTATTTCACCTTGAGCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052787219 Original CRISPR AAATAGGCAATTTGGGCTAT AGG (reversed) Intergenic
No off target data available for this crispr