ID: 1052787923

View in Genome Browser
Species Human (GRCh38)
Location 9:32847029-32847051
Sequence CCAAGGCATATGGGCAACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052787923_1052787931 22 Left 1052787923 9:32847029-32847051 CCCAGGTTGCCCATATGCCTTGG No data
Right 1052787931 9:32847074-32847096 CTTCCTTGAGTCAGAGAAGATGG No data
1052787923_1052787933 25 Left 1052787923 9:32847029-32847051 CCCAGGTTGCCCATATGCCTTGG No data
Right 1052787933 9:32847077-32847099 CCTTGAGTCAGAGAAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052787923 Original CRISPR CCAAGGCATATGGGCAACCT GGG (reversed) Intergenic
No off target data available for this crispr