ID: 1052789678

View in Genome Browser
Species Human (GRCh38)
Location 9:32863630-32863652
Sequence CATTTTGCACTGATGAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052789674_1052789678 18 Left 1052789674 9:32863589-32863611 CCATCAATCACATAGTCAGTAGA No data
Right 1052789678 9:32863630-32863652 CATTTTGCACTGATGAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052789678 Original CRISPR CATTTTGCACTGATGAAGAT AGG Intergenic
No off target data available for this crispr