ID: 1052789872

View in Genome Browser
Species Human (GRCh38)
Location 9:32865351-32865373
Sequence TTACCCTGCATCACAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052789872_1052789876 21 Left 1052789872 9:32865351-32865373 CCACCCACTGTGATGCAGGGTAA No data
Right 1052789876 9:32865395-32865417 TCGTCATCAAAATTCATTCTGGG No data
1052789872_1052789875 20 Left 1052789872 9:32865351-32865373 CCACCCACTGTGATGCAGGGTAA No data
Right 1052789875 9:32865394-32865416 ATCGTCATCAAAATTCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052789872 Original CRISPR TTACCCTGCATCACAGTGGG TGG (reversed) Intergenic
No off target data available for this crispr