ID: 1052791356

View in Genome Browser
Species Human (GRCh38)
Location 9:32878079-32878101
Sequence CTTTCTCTGTTTTTGCCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052791356_1052791361 25 Left 1052791356 9:32878079-32878101 CCGAGAGGCAAAAACAGAGAAAG No data
Right 1052791361 9:32878127-32878149 AAGTTATTCAGATCAGACCAGGG No data
1052791356_1052791360 24 Left 1052791356 9:32878079-32878101 CCGAGAGGCAAAAACAGAGAAAG No data
Right 1052791360 9:32878126-32878148 CAAGTTATTCAGATCAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052791356 Original CRISPR CTTTCTCTGTTTTTGCCTCT CGG (reversed) Intergenic
No off target data available for this crispr