ID: 1052791357

View in Genome Browser
Species Human (GRCh38)
Location 9:32878109-32878131
Sequence AACTTGTCGGCTGTGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052791357_1052791361 -5 Left 1052791357 9:32878109-32878131 CCATCTTCCACAGCCGACAAGTT No data
Right 1052791361 9:32878127-32878149 AAGTTATTCAGATCAGACCAGGG No data
1052791357_1052791360 -6 Left 1052791357 9:32878109-32878131 CCATCTTCCACAGCCGACAAGTT No data
Right 1052791360 9:32878126-32878148 CAAGTTATTCAGATCAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052791357 Original CRISPR AACTTGTCGGCTGTGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr