ID: 1052794232

View in Genome Browser
Species Human (GRCh38)
Location 9:32908261-32908283
Sequence TAGCCAAGATTCCTGAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052794228_1052794232 2 Left 1052794228 9:32908236-32908258 CCTGCCAAGACAGCCAGGACCTA No data
Right 1052794232 9:32908261-32908283 TAGCCAAGATTCCTGAAGAGAGG No data
1052794229_1052794232 -2 Left 1052794229 9:32908240-32908262 CCAAGACAGCCAGGACCTAAATA No data
Right 1052794232 9:32908261-32908283 TAGCCAAGATTCCTGAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052794232 Original CRISPR TAGCCAAGATTCCTGAAGAG AGG Intergenic
No off target data available for this crispr