ID: 1052796175

View in Genome Browser
Species Human (GRCh38)
Location 9:32925553-32925575
Sequence TTCGGCCAAGACTACATGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052796174_1052796175 -7 Left 1052796174 9:32925537-32925559 CCACAGTCAATGTTCATTCGGCC No data
Right 1052796175 9:32925553-32925575 TTCGGCCAAGACTACATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052796175 Original CRISPR TTCGGCCAAGACTACATGCT TGG Intergenic
No off target data available for this crispr